2024-03-28T18:19:06Z
http://horizonepublishing.com/journals/index.php/PST/oai
oai:ojs.horizonepublishing.com:article/6
2017-05-20T13:20:04Z
PST:RCOM
driver
nmb a2200000Iu 4500
"140101 2014 eng "
2348-1900
dc
Accumulation of class-III type of boiling stable Peroxidases in response to plant growth hormone ABA in <em>Triticum aestivum</em> cultivars
Sharma, Arun Dev
PG Dept of Biotechnology, Lyallpur Khalsa College, Jalandhar 144001, Punjab
Rakhra, Gurmeen
PG Dept of Biotechnology, Lyallpur Khalsa College, Jalandhar 144001, Punjab
Mamik, Shubneet
PG Dept of Biotechnology, Lyallpur Khalsa College, Jalandhar 144001, Punjab
Mehta, Shweta
PG Dept of Biotechnology, Lyallpur Khalsa College, Jalandhar 144001, Punjab
Abscisic acid (ABA) is a key plant growth and stress hormone involved in many biological processes. It has been shown to be involved in Reactive Oxygen Species (ROS) generation. Class-III Peroxidases (PODs) are known to maintain oxidative stress induced-ROS at sub-lethal levels in plants under abiotic stress conditions, but, studies documenting how ABA regulates boiling stable class-III PODs are still a matter of conjuncture. In this study, the ABA-induced changes on ROS and ROS scavenging class III boiling stable POD were studied in the embryos of different cultivars of wheat. Simultaneous analysis of ROS contents, activities of ROS-scavenging class- III boiling stable POD enzymes gave an integrative view of physiological state and detoxifying potential under conditions of sensitivity and tolerance. Indices of oxidative stress viz., superoxide radical and H2O2 content increased under ABA treatment in a genotype dependent manner. It was observed that cultivars :PBW 550, HD 2967 and PBW 621 have more efficient mechanism to scavenge ROS species as shown by increase in BsPOD activity accompanied by enhanced expression of boiling stable POD isoenzymes. Based on results it can be inferred that embryos of cvs. PBW 550, HD 2967 and PBW 621 have more capacity to perform biological antioxidative reactions to combat ABA-induced oxidative stress.
Horizon e-Publishing Group
2014-01-01 00:00:00
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/p3-9
Plant Science Today; Vol. 1 No. 1 (2014)
eng
Copyright (c) 2014 Arun Dev Sharma, Gurmeen Rakhra, Shubneet Mamik, Shweta Mehta
oai:ojs.horizonepublishing.com:article/7
2017-05-20T13:20:04Z
PST:RCOM
driver
nmb a2200000Iu 4500
"140101 2014 eng "
2348-1900
dc
Cis-ocimenone chemotype essential oil of green mint (<em>Mentha viridis</em> L.) from Western Ghats region of North West Karnataka, India
Joshi, R.K.
1Department of Phytochemistry, Regional Medical Research Centre (Indian Council of Medical Research), Belgaum, Karnataka-590 010, India
Sharma, A. K.
Department of Pharmacy, G.S.V.M. Medical College Kanpur, Uttar Pradesh-208002, India
The hydro-distilled essential oil of the leaves of Mentha viridis L. was analyzed by gas chromatography equipped with flame ionization detector (GC-FID) and gas chromatography coupled with mass spectrometry (GC/MS). A total of fifty constituents have been identified, accounting 95.4% of the total oil. The major compounds were identifies as cis-ocimenone (61.7%), limonene (10.5%) and trans-carveol (5.0%). The essential oil consists mainly of oxygenated monoterpenes (73.1%), followed by monoterpene hydrocarbons (14.2%), sesquiterpene hydrocarbons (5.2%), phenyl derivatives (1.5%), and oxygenated sesquiterpenes (1.4%). This study revealed that the leaves of M. viridis produced cis-ocimenone chemotype form Western Ghats of North West Karnataka, India.
Horizon e-Publishing Group
2014-01-01 00:00:00
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/p10-12
Plant Science Today; Vol. 1 No. 1 (2014)
eng
Copyright (c) 2014 R.K. Joshi, A. K. Sharma
oai:ojs.horizonepublishing.com:article/13
2017-05-20T13:20:03Z
PST:RCOM
driver
nmb a2200000Iu 4500
"140224 2014 eng "
2348-1900
dc
The mutagenic effect of hydroxylamine hydrochloride on the agronomic traits of Sesame (<i>Sesamum indicum</i> L.)
Birara, Abraham
Biology Department, College of Natural and Computational Sciences (CNCS), Mekelle University, Mekelle, P.O. Box 231, Ethiopia
Manikandan, Muthuswamy
Biology Department, College of Natural and Computational Sciences (CNCS), Haramaya University, Dire Dawa, P.O. Box 138, Ethiopia
Andargie, Mebeaselassie
Biology Department, College of Natural and Computational Sciences (CNCS), Haramaya University, Dire Dawa, P.O. Box 217, Ethiopia
The effects of mutation induction through the use of a chemical mutagen as a method of improving few agronomic traits in sesame (Sesamum indicum L.) were investigated. Healthy and dry seeds of sesame varieties (Abasena and Kelafo 74) were treated with hydroxylamine hydrochloride (HA) at six different concentrations (0.01, 0.02, 0.03, 0.04, 0.05 % (w/v) and control) with the aim of improving the growth and yield parameters of the plant. Bioassay studies showed highly significant difference in germination percentage of the two varieties under the treatment of the mutagen compared to the control. The results obtained from the quantitative parameters also revealed highly significant increase (P=0.01) in the plant heights, number of seeds/pod, number of capsules/plant, internode length and capsule length with decrease in the concentration of the mutagen. In addition, days to maturity have shown a negative mean shift in all the treatments and days to flowering showed a significant positive mean shift only at 0.02% concentration of HA. The chemical mutagen was therefore found to improve the quantitative traits associated with growth and yield of sesame. The induced variation can be exploited in the evolution of new varieties of sesame with improved agronomic traits.
Horizon e-Publishing Group
2014-01-01 00:00:00
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/13
Plant Science Today; Vol. 1 No. 1 (2014)
eng
Copyright (c) 2014 Abraham Birara, Muthuswamy Manikandan, Mebeaselassie Andargie
oai:ojs.horizonepublishing.com:article/29
2017-05-20T13:20:03Z
PST:RCOM
driver
nmb a2200000Iu 4500
"140815 2014 eng "
2348-1900
dc
Ferronickel slag toxicity tests on Chlorella vulgaris and Artemia sp.
Tangahu, Bieby Voijant
Institut Teknologi Sepuluh Nopember (ITS)
Saptarini, Dian
Department of Biology, Institut Teknologi Sepuluh Nopember, Surabaya
Warmadewanthi, IDAA
Department of Enviromental Engineering, Institut Teknologi Sepuluh Nopember, Surabaya
Pudjiastuti, Lily
Department of Chemical Engineering, Institut Teknologi Sepuluh Nopember, Surabaya
Tardan, Mas Agus Mardyanto
Department of Enviromental Engineering, Institut Teknologi Sepuluh Nopember, Surabaya
Luqman, Arif
Department of Enviromental Engineering, Institut Teknologi Sepuluh Nopember, Surabaya
Acute effects of ferronickel slag toxicity on Chlorella vulgaris and Artemia sp. were studied. Tests were conducted on ferronickel slag to determine the concentration of heavy metals leached out to the environment. Toxicity tests were also carried out on the organisms with minimum exposure duration of 4 days or until the occurrence of a negative effect. About 400 cells mL-1 of C. vulgaris and 20 individuals of Artemia sp. were used in each of the reactors with media containing slag concentration ranged from 0 to 50%. Results showed that the IC50 (inhibition concentration) value of the percentage of slag (w/v) for C. vulgaris was 5-10%. Slag toxicity test on Artemia showed that LC50 (lethal concentration) for the percentage of slag was also between 5-10%. The study proved beyond doubt the acute effects of the slag at low concentration (10% w/v) as indicated by the inhibition of growth of 60% of the C. vulgaris population and deaths of more than 50% of the Artemia in the reactors. Hence the study suggests wise use of the slag to avoid disturbances to environment and society at large.
Horizon e-Publishing Group
2014-06-30 23:55:33
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/29
Plant Science Today; Vol. 1 No. 3 (2014)
eng
Copyright (c) 2014 Bieby Voijant Tangahu, Dian Saptarini, IDAA Warmadewanthi, Lily Pudjiastuti, Mas Agus Mardyanto Tardan, Arif Luqman
oai:ojs.horizonepublishing.com:article/52
2017-05-20T13:20:03Z
PST:RCOM
driver
nmb a2200000Iu 4500
"140701 2014 eng "
2348-1900
dc
Chemical composition of the essential oil of Ocimum tenuiflorum L. (Krishna Tulsi) from North West Karnataka, India
Joshi, R. K.
Department of Phytochemistry, Regional Medical Research Centre, Belgaum, Karnataka 590010
Hoti, S. L.
Regional Medical Research Centre, Belgaum, Karnataka 590010
The chemical composition of the essential oil of flowering aerial parts of Ocimum tenuiflorum L. growing in the North West Karnataka, India, was investigated. The hydro-distilled essential oil was analyzed by gas chromatography equipped with flame ionization detector (GC-FID) and gas chromatography coupled with mass spectrometry (GC/MS). Results demonstrated that the oil was found to be rich in phenyl derivative compounds (83.8%). The major compound was identified as methyl eugenol (82.9%) among twenty-six compounds, comprising 98.9% of the total oil.
Horizon e-Publishing Group
2014-06-30 23:55:33
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/52
Plant Science Today; Vol. 1 No. 3 (2014)
eng
Copyright (c) 2014 R. K. Joshi, S. L. Hoti
oai:ojs.horizonepublishing.com:article/82
2017-10-18T12:53:44Z
PST:RCOM
driver
nmb a2200000Iu 4500
"150101 2015 eng "
2348-1900
dc
First report of Septoria silybi associated with leaf blotch of Silybum marianum from Iran
Jamali, Samad
Department of Plant Protection, College of Agriculture, Razi University, Kermanshah, Iran
During March to April 2013, in the course of routine sample collection, a leaf spot disease was observed on Silybum marianum in different areas of Kermanshah province, Iran. Initial symptoms of the disease were pale brown, necrotic lesions, mostly 8-10 mm long on leaves. On the surface of the infected leaves conidiomata were observed, which were pycnidial, amphigenous, scattered, dark brown to blackish, globose, immersed in host tissue, becoming partly erumpent, unilocular, 90-150 µm in diameter, with an ostiole of 18-24 µm in diameter. Conidiogenesis was enteroblastic. Conidia were hyaline, filiform, sub-straight to mildly flexuous, truncate at the base, 20-48 × 1.2-2.8 µm, 2-5-septate, with indistinct septa. On the basis of symptoms, fungal morphology and completion of Koch’s postulate, the fungal isolates from the leaf spots were identified as Septoria silybi. This is the first report of S. silybi on leaves of S. marianum in Iran.
Horizon e-Publishing Group
2015-01-01 03:00:12
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/82
Plant Science Today; Vol. 2 No. 1 (2015)
eng
Copyright (c) 2014 Samad Jamali
oai:ojs.horizonepublishing.com:article/84
2017-05-20T13:18:13Z
PST:RCOM
driver
nmb a2200000Iu 4500
"150401 2015 eng "
2348-1900
dc
The aeration effect in pilot reed bed to phytoremediate water containing Lead (Pb)
Tangahu, Bieby Voijant
Department of Environmental Engineering, Faculty of Civil Engineering and Planning, Sepuluh Nopember Institute of Technology (ITS), Kampus ITS Sukolilo, Surabaya 60111, Indonesia
Sheikh Abdullah, Siti Rozaimah
Department of Chemical and Process Engineering, Faculty of Engineering and Built Environment, Universiti Kebangsaan Malaysia (UKM), 43600 UKM Bangi, Selangor, Malaysia
Basri, Hassan
Department of Civil and Structural Engineering, Faculty of Engineering and Built Environment, Universiti Kebangsaan Malaysia (UKM), 43600 UKM Bangi, Selangor, Malaysia
Idris, Mushrifah
Tasik Chini Reasearch Centre, Faculty of Science and Technology, Universiti Kebangsaan Malaysia (UKM), 43600 UKM Bangi, Selangor, Malaysia
Anuar, Nurina
Department of Chemical and Process Engineering, Faculty of Engineering and Built Environment, Universiti Kebangsaan Malaysia (UKM), 43600 UKM Bangi, Selangor, Malaysia
Mukhlisin, Muhammad
Department of Civil and Structural Engineering, Faculty of Engineering and Built Environment, Universiti Kebangsaan Malaysia (UKM), 43600 UKM Bangi, Selangor, Malaysia
A pilot reed bed study was conducted with the aid of aeration to remove lead (Pb) contaminated water using Scirpus grossus L. f. The plants were grown in sand medium in pilot-scale reed beds, and exposed to water containing Pb in a various concentration (10, 30 and 50 mg/L) with aeration rate of 2 L/min. The samples were taken on day-1, day-14, day-28, day-42, day-70 and day-98. The results showed that Pb concentration in water decreased 74% on day-7, 80% on day-14, 99% on day-28 and reach 100% on day-48 for treatment 10 mg/L. Pb concentration decreased 91% on day-7, 93% on day-14 and then on the day-28 the reduction reached 99% for treatment of 30 mg/L. For Pb treatment of 50 mg/L, the reduction reached 92% on day-7, 96% on day-14, and 99% on day-28. The sand adsorbed Pb up to 7.91×10-4 mg/kg for 10 mg/L, 1.07×10-3 mg/kg for 30 mg/L and 2.41×10-3 mg/kg for 50 mg/L. Pb uptake by plant was 2286 mg/kg on day-98, 4174 mg/L on day-28 and 8297 mg/kg on day-14 for 10, 30 and 50 mg/L, respectively. The highest Bioaccumulation Concentration (BC) was 10618 for 10 mg/L on day-28, 81311 for 30 mg/L and 81467 for 50 mg/L both on day-42, with the Translocation Factor (TF) related to the same day of these BC were 0.13, 0.24, and 0.35 respectively. The highest TF value for 10 mg/L were 0.7 on day-98, 0.38 for 30 mg/L on day-70 and 0.59 for 50 mg/L on day-14.
Horizon e-Publishing Group
2015-03-31 00:00:00
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/84
Plant Science Today; Vol. 2 No. 2 (2015)
eng
Copyright (c) 2015 Bieby Voijant Tangahu, Siti Rozaimah Sheikh Abdullah, Hassan Basri, Mushrifah Idris, Nurina Anuar and Muhammad Mukhlisin
oai:ojs.horizonepublishing.com:article/87
2017-10-18T12:48:55Z
PST:RCOM
driver
nmb a2200000Iu 4500
"150101 2015 eng "
2348-1900
dc
Comparative HPTLC analysis of stem and leaf of Achyranthes coynei with Achyranthes aspera
Upadhya, Vinayak
Ethnomedicine Division, Regional Medical Research Centre (RMRC), Indian Council of Medical Research (ICMR), Nehru Nagar, Belgaum – 590 010, Karnataka, India
Ankad, Gireesh M
Ethnomedicine Division, Regional Medical Research Centre (RMRC), Indian Council of Medical Research (ICMR), Nehru Nagar, Belgaum – 590 010, Karnataka, India
Pai, Sandeep Ramchandra
Plant Biotechnology and Tissue Culture Division, Regional Medical Research Centre (RMRC), Indian Council of Medical Research (ICMR), Nehru Nagar, Belgaum – 590 010, Karnataka, India http://orcid.org/0000-0002-1133-8061 http://orcid.org/0000-0002-1133-8061
Hegde, Harsha V
Regional Medical Research Centre (RMRC), Indian Council of Medical Research (ICMR), Nehru Nagar, Belgaum – 590 010, Karnataka, India
Leaf and stem materials of Achyranthes coynei and Achyranthes aspera were used for HPTLC analysis. HPTLC plates were developed on n-hexane: ethyl acetate (5:1 v/v) solvent system. The densitometric profiles were evaluated to elucidate differences within and among the species. The Rf values and number of peaks obtained in densitrogram indicated chemical variation in the species. Although, both species had more or less equal number of peaks, their Rf values, %height and %area varied. Thus HPTLC analysis in absence of external standards, proved to be an informative tool for evaluating differences between these species and their parts.
Horizon e-Publishing Group
2015-01-01 03:00:12
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/87
Plant Science Today; Vol. 2 No. 1 (2015)
eng
Copyright (c) 2014 Vinayak Upadhya, Gireesh M Ankad, Sandeep Ramchandra Pai, Harsha V Hegde
oai:ojs.horizonepublishing.com:article/88
2017-05-20T13:18:13Z
PST:RCOM
driver
nmb a2200000Iu 4500
"150208 2015 eng "
2348-1900
dc
Floral diversity and ecology in Kalyani area of Nadia district, West Bengal, India
Biswas, Saikat
Department of Botany, R.P.M. College (University of Calcutta), Uttarpara, Hooghly 712258, West Bengal, India
Maiti, Mayum
Department of Botany, R.P.M. College (University of Calcutta), Uttarpara, Hooghly 712258, West Bengal, India
Bhandari, Gita
Department of Botany, R.P.M. College (University of Calcutta), Uttarpara, Hooghly 712258, West Bengal, India
Batabyal, Rimpa
Department of Botany, R.P.M. College (University of Calcutta), Uttarpara, Hooghly 712258, West Bengal, India
Patra, Jhilam
Department of Botany, R.P.M. College (University of Calcutta), Uttarpara, Hooghly 712258, West Bengal, India
Bhuiya, Anirban
Department of Botany, R.P.M. College (University of Calcutta), Uttarpara, Hooghly 712258, West Bengal, India
Ojha, Bratati
Department of Botany, R.P.M. College (University of Calcutta), Uttarpara, Hooghly 712258, West Bengal, India
Halder, Nilu
Department of Botany, R.P.M. College (University of Calcutta), Uttarpara, Hooghly 712258, West Bengal, India http://www.rpmcollege.org
Talukdar, Dibyendu
Department of Botany, R.P.M. College (University of Calcutta), Uttarpara, Hooghly 712258, West Bengal, India http://orcid.org/0000-0003-4319-6077
An assessment of plant diversity was carried out to record different species of flowering plants (Angiosperms) in Kalyani township of Nadia district, West Bengal, India during January, 2014. All together 6 quadrats were laid down, and 30 flowering plant species belonging to 15 families were documented. Voucher specimens were preserved and digitized in departmental phyto-informatics center. Frequency and density varied greatly among the taxa, while many species were not evenly abundant in the study area. Out of total species, 11 species can be used as economic and medicinal plants. There are also some alien invasive species of diverse origin.
Horizon e-Publishing Group
2015-01-01 03:00:12
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/88
Plant Science Today; Vol. 2 No. 1 (2015)
eng
Copyright (c) 2015 Saikat Biswas, Mayum Maiti, Gita Bhandari, Rimpa Batabyal, Jhilam Patra, Anirban Bhuiya, Bratati Ojha, Nilu Halder, Dibyendu Talukdar
oai:ojs.horizonepublishing.com:article/92
2017-10-18T12:26:46Z
PST:RCOM
driver
nmb a2200000Iu 4500
"150101 2015 eng "
2348-1900
dc
Changes in henna (Lawsonia inermis L.) morphological traits under different deficit irrigations in the southern Tunisia
Enneb, Hanen
Laboratory of Dryland and Oasis Cropping, Institute of Arid Zone of Medenine, ElFjè, Medenine 4119, Tunisia
Belkadhi, Aicha
Department of Biology, Unité de Recherche de Physiologie et Biochimie de la tolérance des plantes aux contraintes abiotiques, Faculty of Sciences of Tunis, University of Tunis El Manar, 1060 Tunis, Tunisia https://twitter.com/ABelkadhi http://orcid.org/0000-0001-5911-0974
Ferchichi, Ali
Laboratory of Dryland and Oasis Cropping, Institute of Arid Zone of Medenine, ElFjè, Medenine 4119, Tunisia
Henna plant belongs to continental oases where water shortage constitutes the essential limiting factors of its agricultural production. Lawsonia inermis L. (Lytraceae) is often exposed to severe drought stress in Gabes; a Tunisian arid region. The present study was carried out to evaluate the impact of water stress on the morphology of Tunisian henna plants. Thus, an experiment of four months was carried out under greenhouse at the Institute of Arid Region in Medenine, Tunisia. Henna was exposed to three different irrigation regimes, whereby the plants where irrigated to field capacity (control, T0), 50% of the control (moderate stress, T1) and 25% of the control (severe deficit irrigation, T2). Results showed that, leaf area (LA), leaf number and stem length of henna, decreased in response to the studied stress. The effect of water stress was clearly observed on those parameters. Moderate drought (T1) did not damage henna morphology, and the plants grew better than without water limitation (T0). Furthermore, the water stress-typical responses were shown as time and severity dependent in all the measured parameters. Indeed, lowest water availability treatment (T2) induced significant decrease in total number of leaves, as well as reductions in LA. Under this severe water stress (T2); LA was reduced by 65.79%, compared to control, at 60 days after the initiation of the bioassay. Stem length decreased significantly in the most severe water stress, this reduction was about 44%. Globally, we conclude that henna plant growth decreased progressively to long-term water limitation.
Horizon e-Publishing Group
2015-01-01 03:00:12
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/92
Plant Science Today; Vol. 2 No. 1 (2015)
eng
Copyright (c) 2014 Hanen Enneb, Aicha Belkadhi, Ali Ferchichi
oai:ojs.horizonepublishing.com:article/97
2017-05-20T13:18:13Z
PST:RCOM
driver
nmb a2200000Iu 4500
"150403 2015 eng "
2348-1900
dc
Seedling development of nodulating and non-nodulating native legumes in soils from Brazilian Caatinga biome
Menezes, Kelly Alexsandra Souza
Universidade do Estado da Bahia, Departamento de Tecnologias e Ciências Sociais, Juazeiro, Bahia state, Brazil
Nunes, Gersika Fakirra de Oliveira
Universidade do Estado da Bahia, Departamento de Tecnologias e Ciências Sociais, Juazeiro, Bahia state, Brazil
Sampaio, Aline Araujo
Universidade do Estado da Bahia, Departamento de Tecnologias e Ciências Sociais, Juazeiro, Bahia state, Brazil
Aidar, Saulo de Tarso
Embrapa Semiárido, Petrolina, Pernambuco state, Brazil
Martins, Lindete Miria Vieira
Universidade do Estado da Bahia, Departamento de Tecnologias e Ciências Sociais, Juazeiro, Bahia state, Brazil
Fernandes-Júnior, Paulo Ivan
Embrapa Semiárido, Petrolina, Pernambuco state, Brazil
This study aimed to evaluate the initial development of the nodulating legumes jurema-rosa (Mimosa verrucosa Benth.) and angico [Anadenanthera colubrina (Vell.) Brenan] and the non-nodulating legumes umburana-de-cheiro [Amburana cearensis (Allemao) A.C. Smith] and caatingueira-verdadeira [Poincianella pyramidalis (Tul.) L.P. Queiroz]. Plants were grown in pots containing soil samples from six areas in Brazilian Caatinga biome region. Differences at the nodulation in plant roots were observed among the soils studied, pointing out a Vertisol covered by an introduced legume. The leaf gas exchange evaluations also showed differences among the plants grown in the different soils used as substrate mainly to angico and caatingueira-verdadeira.
Horizon e-Publishing Group
2015-03-31 00:00:00
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/97
Plant Science Today; Vol. 2 No. 2 (2015)
eng
Copyright (c) 2015 Kelly Alexsandra Souza Menezes, Gersika Fakirra de Oliveira Nunes, Aline Araujo Sampaio, Saulo de Tarso Aidar, Lindete Miria Vieira Martins, Paulo Ivan Fernandes-Júnior
oai:ojs.horizonepublishing.com:article/99
2017-10-18T15:05:45Z
PST:RCOM
driver
nmb a2200000Iu 4500
"150404 2015 eng "
2348-1900
dc
Biochemical response of three Vigna mungo varieties (T9, RBU38 and VM4) under drought stress
Pandey, Sonali
Department of Bioscience and Biotechnology, Banasthali Vidyapith, Rajasthan 304022, India
Chakraborty, Dipjyoti
Department of Bioscience and Biotechnology, Banasthali Vidyapith, Rajasthan 304022, India http://orcid.org/0000-0003-4784-4799
Plants apply several strategies that are developed during their evolution and artificial domestication to overcome biotic and abiotic stresses. Among eminent environmental threats drought stress is a major factor that affects plants at physiological, biochemical and molecular level. Blackgram (Vigna mungo) is an important pulse crop but its productivity is adversely affected by drought. In the present work, different cultivars of blackgram i.e. T9, RBU38 and VM4 are taken to find out the effects of drought stress by the estimation of different biochemical parameters to better understand biochemical pathway modulations under stress and its possible mitigation. Damage to photosynthetic machinery as evident by decrease in chlorophyll content and loss of membrane integrity in the plants under drought stress. The adverse effects of drought on the plants were averted to a certain extent in RBU38 by activation of defence signalling through H2O2 at lower concentration, which proved damaging at high concentration for T9 and VM4 and a concurrent increase in proline content which may provide protection against oxidative stress. This study suggests that drought modulated biochemical parameters can be used as reliable indices for selection of genotypes with a better stress tolerance.
Horizon e-Publishing Group
2015-03-31 00:00:00
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/99
Plant Science Today; Vol. 2 No. 2 (2015)
eng
Copyright (c) 2015 Sonali Pandey, Dipjyoti Chakraborty
oai:ojs.horizonepublishing.com:article/102
2017-05-20T13:18:12Z
PST:RCOM
driver
nmb a2200000Iu 4500
"150406 2015 eng "
2348-1900
dc
Back to the future: Evidence of ancestral polymorphism in current populations of Anadenanthera colubrina var. cebil by means of Population Graphs
Barrandeguy, María Eugenia
Departamento de Genética. Facultad de Ciencias Exactas, Químicas y Naturales. Universidad Nacional de Misiones; Posadas 3300 Misiones, Argentina
García, María Victoria
Instituto de Biología Subtropical Nodo Posadas, Argentina
Population Graphs includes network theory to infer the relationship among individuals or populations and their respective roles. The hypothesis for this work establishes that Argentinean natural populations of Anadenanthera colubrina var. cebil keep ancestral polymorphism as a consequence of continuous historical distribution of this species in South America. Network analyses were performed centered on individuals and populations using two different measures which integrate genetic information in terms of time and divergence history. These analyses allow us to conclude that the populations of A. colubrina var. cebil display geographical isolation even though they are historically related.
Horizon e-Publishing Group
2015-03-31 00:00:00
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/102
Plant Science Today; Vol. 2 No. 2 (2015)
eng
Copyright (c) 2015 María Eugenia Barrandeguy, María Victoria García
oai:ojs.horizonepublishing.com:article/103
2017-10-18T13:19:26Z
PST:RCOM
driver
nmb a2200000Iu 4500
"150101 2015 eng "
2348-1900
dc
RP-HPLC analysis of phenolic antioxidant compound 6-gingerol from in vitro cultures of Zingiber officinale Roscoe
Pawar, Nilesh V
Department of Botany, The New College, Kolhapur, MS – 416 012, India
Pai, Sandeep R
Regional Medical Research Centre, ICMR, Belgaum (Karnataka), India http://orcid.org/0000-0002-1133-8061
Nimbalkar, Mansingraj S
Department of Botany, Shivaji University, Kolhapur – 416 004 (MS), India
Dixit, Ghansham B
Department of Botany, Shivaji University, Kolhapur – 416 004 (MS), India
Relation between 6-gingerol content and antioxidant activity in in vitro grown cultures of ginger was studied. Reverse phase HPLC analysis revealed that rhizome derived callus culture and micropropagated plants produced lowest amount of 6-gingerol compare to conventionally grown plants. The antioxidant activity of extracts was determined using 1,1-diphenyl-2-picrylhydrazyl (DPPH) radical scavenging assay and Ferric Reducing power assay (FRAP) and correlated with the content of total phenolics and total flavonoids in the extracts. Strong correlation was found between antioxidant activity, total phenolics and 6- gingerol content.
Horizon e-Publishing Group
2015-01-01 03:00:12
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/103
Plant Science Today; Vol. 2 No. 1 (2015)
eng
Copyright (c) 2014 Nilesh V Pawar, Sandeep R Pai, Mansingraj S Nimbalkar, Ghansham B Dixit
oai:ojs.horizonepublishing.com:article/111
2017-05-20T13:18:12Z
PST:RCOM
driver
nmb a2200000Iu 4500
"150409 2015 eng "
2348-1900
dc
Response of oranje Natal Folha Murcha (Citrus sinensis (L.) Osbeck) at different levels of irrigation
Lima, Gabriel Costa
Federal University of the Espirito Santo, Brazil
Martins, Madlles Queiroz
Federal University of the Espirito Santo, Brazil
Coelho, Ruimário Inácio
Federal University of the Espirito Santo, Brazil
With the aim of studying the effect of the irrigation rate on the yield and fruit quality of sweet orange (Citrus sinensis (L.) Osbeck) cv. Folha Murcha, an experiment was conducted in Sítio Jacutinga located in the county of Jeronimo Monteiro, Espirito Santo, Brazil, using orange of the variety Folha Murcha grafted on mandarim Cleópatra, with five years of age, spaced 5 m between rows and 4 m between plants within the line. Five treatments were implemented each with a different irrigation regime (L0 = without irrigation; L1 = 50% of PET; L2 = 75% of PET; L3 = 100% of PET and L4 = 125% of PET), defined based on potential evapotranspiration estimated by the method of Tank Class A. the experimental design was a randomized block with three replications consisting of nine plants in each repetition. In this study, yield per plant (kg), diameter and height of the fruit were evaluated. The irrigation regime 125% of the PET promoted the highest yield of orange Folha Murcha, under the conditions of this study.
Horizon e-Publishing Group
2015-03-31 00:00:00
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/111
Plant Science Today; Vol. 2 No. 2 (2015)
eng
Copyright (c) 2015 Gabriel Costa Lima, Madlles Queiroz Martins, Ruimário Inácio Coelho
oai:ojs.horizonepublishing.com:article/114
2017-05-20T13:18:12Z
PST:RCOM
driver
nmb a2200000Iu 4500
"150408 2015 eng "
2348-1900
dc
Cytopathology, biology and molecular characterization of two Italian isolates of Malva vein clearing virus
Parrella, Giuseppe
Istituto per la Protezione Sostenibile delle Piante del CNR, Via Università 133, 80055 Portici, Italy http://www.ipp.cnr.it/
Nappo, Anna Giulia
Istituto per la Protezione Sostenibile delle Piante del CNR, Via Università 133, 80055 Portici, Italy http://www.ipp.cnr.it/
Delecolle, Brigitte
INRA, Station de Pathologie Végétale, B.P. 94, 84143 Montfavet Cedex, France
Two Italian isolates of Malva vein clearing virus (MVCV), naturally infecting Malva sylvestris (common mallow) plants, were characterized at biological, serological and molecular level. Experimental host range was comparable for both isolates and in agreement with those reported for other MVCV isolates. Cytopathology observed indicated type I of cylindrical inclusions caused by both isolates in common mallow. The 3’ genome extremity of about 1800 nucleotides was sequenced for both isolates. It comprised of the 3’ end of the NIb gene, the entire putative ORF of the coat protein (CP) and the 3’ non-translated region of genome. Phylogenetic analysis based on CP gene did not shown any statistically significant grouping among ten different MVCV isolates, suggesting low level of variability among the MVCV isolates genetically characterized until now.
Horizon e-Publishing Group
2015-03-31 00:00:00
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/114
Plant Science Today; Vol. 2 No. 2 (2015)
eng
Copyright (c) 2015 Giuseppe Parrella, Anna Giulia Nappo, Brigitte Delecolle
oai:ojs.horizonepublishing.com:article/163
2017-05-20T13:18:11Z
PST:RCOM
driver
nmb a2200000Iu 4500
"160101 2016 eng "
2348-1900
dc
Antimicrobial activity of leaf and root methanolic extracts from Vinca pusilla Murr.
Ankad, Gireesh
Regional Medical Research Centre, ICMR, Nehru Nagar, Belagavi
Pednekar, Harsha
Regional Medical Research Centre, ICMR, Nehru Nagar, Belagavi
Pai, Sandeep R
Regional Medical Research Centre, ICMR, Nehru Nagar, Belagavi http://orcid.org/0000-0002-1133-8061
Hegde, Harsha
Regional Medical Research Centre, ICMR, Nehru Nagar, Belagavi, Karnataka, India
Roy, Subarna
Regional Medical Research Centre, ICMR, Nehru Nagar, Belagavi
Hoti, S
Regional Medical Research Centre, ICMR, Nehru Nagar, Belagavi, Karnataka
Vinca pusilla Murr. is a traditional medicinal plant used to treat several diseases. To substantiate the traditional medicinal utility of the plant, the present study aims at screening the antimicrobial activity of methanolic extracts of leaves and roots against five Gram positive, five Gram negative bacterial and four fungal strains. The minimum inhibitory concentration (MIC) were determined by two fold dilution assay. The results indicated that, leaf and root extracts were more effective on Bacillus subtilis and Staphylococcus aureus strains (MIC < 1 mg/mL). The tested organisms were sensitive to root extract compared to leaf extract. Fungal strains were resistant than the bacterial strains to both the extracts. Thus the present study illustrates the antimicrobial potential of the plant.
Horizon e-Publishing Group
2015-12-31 23:49:04
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/163
Plant Science Today; Vol. 3 No. 1 (2016)
eng
Copyright (c) 2016 Gireesh Ankad, Harsha Pednekar, Sandeep Pai, Harsha Hegde, Subarna Roy, S Hoti
oai:ojs.horizonepublishing.com:article/185
2017-05-20T12:58:58Z
PST:RCOM
driver
nmb a2200000Iu 4500
"160325 2016 eng "
2348-1900
dc
Plagiochila parvivittata Inoue var. siangensis var. nov. (Plagiochilaceae, Marchantiophyta) from Arunachal Pradesh, India
Singh Deo, Siddhartha
Botanical Survey of India, Kolkata
Singh, Devendra Kumar
Botanical Survey of India, Kolkata
Plagiochila parvivittata Inoue var. siangensis var. nov. is described from West Siang district in Arunachal Pradesh, Eastern Himalaya, India. The new taxon differs from the typical variety in larger length/breadth ratio of leaves with fewer marginal teeth, (0-) 2–3 teeth along the dorsal margin of leaves near apex, terminal cell of marginal teeth 4–12 (-18) times longer than wide and a very distinct vitta area with the cells measuring 75–114 × 15–21 ?m in size.
Horizon e-Publishing Group
2015-12-31 23:49:04
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/185
Plant Science Today; Vol. 3 No. 1 (2016)
eng
Copyright (c) 2016 Siddhartha Singh Deo, Devendra Kumar Singh
oai:ojs.horizonepublishing.com:article/256
2017-05-20T12:58:55Z
PST:RCOM
driver
nmb a2200000Iu 4500
"161001 2016 eng "
2348-1900
dc
Two new records for the flora of Vietnam: Sonerila (Melastomataceae) and Erycibe (Convolvulaceae)
Dang, Son Van
Institute of Tropical Biology http://orcid.org/0000-0001-8681-4141
Nguyen, Hong Quan
Phu Quoc National Park, 01 Nguyen Chi Thanh Street, District Phu Quoc, Kien Giang Province
Pham, Hong Dung
Phu Quoc National Park, 01 Nguyen Chi Thanh Street, District Phu Quoc, Kien Giang Province
Pham, Van Ngot
Faculty of Biology, The Ho Chi Minh City University of Eudication, 280 An Duong Vuong Street, District 5, Ho Chi Minh City
Mai, Truong
Institute of Tropical Biology, VAST, 85 Tran Quoc Toan Street, District 3, Ho Chi Minh City
Hoang, Nghia Son
Institute of Tropical Biology, VAST, 85 Tran Quoc Toan Street, District 3, Ho Chi Minh City
Two recently discovered species from Phu Quoc National Park in southern Vietnam, Sonerila bokorense S.H. Cho and Y.D. Kim (Melastomataceae) and Erycibe citriniflora Griff. (Convolvulaceae), provide new records for the flora of Vietnam. For each species a taxonomic description is presented, together with information on their distribution, habitat and ecology; color photographs of both species are also given.
Horizon e-Publishing Group
2016-10-01 00:00:00
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/256
Plant Science Today; Vol. 3 No. 4 (2016)
eng
Copyright (c) 2016 Van-Son Dang, Hong-Quan Nguyen, Hong-Dung Pham, Van-Ngot Pham, Truong Mai, Nghia-Son Hoang
oai:ojs.horizonepublishing.com:article/263
2017-05-20T12:58:55Z
PST:RCOM
driver
nmb a2200000Iu 4500
"161001 2016 eng "
2348-1900
dc
Diversity and Distribution of liverworts across habitats and altitudinal gradient at Pachmarhi Biosphere Reserve (India)
Gupta, Reesa
Bryology Laboratory, CSIR- National Botanical Research Institute, Lucknow 226001
Asthana, Ashish Kumar
Bryology Laboratory, CSIR- National Botanical Research Institute, Lucknow 226001
The present study elucidates the distribution of liverworts (Marchantiophyta) in various habitats and across the altitudinal gradients at Pachmarhi Biosphere Reserve (PBR), central India. The liverwort diversity was assessed in selected habitats at each site viz. soil, wet rocks, dry rocks, soil covered rocks, stony walls (terricolous habitats) and epiphytic habitat. Three altitudinal gradients were considered for distributional assessment. In all, 41 liverworts belonging to 21 genera and 15 families were encountered. Among the three altitudinal zones, 17 taxa were found at lower altitudinal gradient (400-800 m) whereas 12 liverworts were found at the higher altitudinal gradient (1001-1400 m). Maximum taxa (33) were present at the middle altitudinal zone (801- 1000 m). The sites at middle altitudes furnished amicable conditions for the growth of bryophytes. In general, rocks, both moist and dry formed the most pertinent habitat for the liverworts. Evidently, the middle altitudinal gradient emerged as the altitudinal range harbouring maximum liverworts.
Horizon e-Publishing Group
2016-10-01 00:00:00
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/263
Plant Science Today; Vol. 3 No. 4 (2016)
eng
Copyright (c) 2016 Reesa Gupta, Ashish Kumar Asthana
oai:ojs.horizonepublishing.com:article/295
2017-05-20T12:58:54Z
PST:RCOM
driver
nmb a2200000Iu 4500
"170405 2017 eng "
2348-1900
dc
Leucobryum aduncum var. scalare (Leucobryaceae: Bryophyta) - new to the Eastern Ghats
Biju, P. M.
Bryology Laboratory, Department of Botany & Research Centre, Scott Christian College (Autonomous), Nagercoil 629003
Daniels, Albert Ebenezer Dulip
Scott Christian College (Autonomous) http://orcid.org/0000-0001-8955-2204
Leucobryum aduncum var. scalare, so far known from the Northeast and the Western Ghats for India, is added here to the moss flora of the Eastern Ghats. A detailed description with figures substantiated by a photo plate and a key to distinguish the species of Leucobryum Hampe from the region.
Horizon e-Publishing Group
2017-04-01 07:57:48
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/295
Plant Science Today; Vol. 4 No. 2 (2017)
eng
Copyright (c) 2017 P.M. Biju, A.E.D. Daniels
oai:ojs.horizonepublishing.com:article/316
2020-08-01T06:41:11Z
PST:RCOM
driver
nmb a2200000Iu 4500
"170714 2017 eng "
2348-1900
dc
Anisochilus carnosus (L. f.) Wall. ex Benth. (Lamiaceae) – a new generic record for Pakistan
Ali, Ashfaq
Hazara University
Rashid, Mahrine
National Herbarium (Stewart Collection)
Sultan, Amir
National Herbarium (Stewart Collection)
Irfan, Muhammad
Hazara University
During an exploration of Gadoon area in district Swabi, Khyber Pakhtunkhwa a specimen of Anisochilus carnosus (L. f.) Wall. ex Benth. was collected which represents a new plant record for Pakistan. Its description and illustrations are provided for easy identification.
Horizon e-Publishing Group
2017-07-01 05:05:15
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/316
Plant Science Today; Vol. 4 No. 3 (2017)
eng
Copyright (c) 2017 Ashfaq Ali, Muhammad Irfan, Mahrine Rashid, Amir Sultan
oai:ojs.horizonepublishing.com:article/334
2020-08-01T06:41:08Z
PST:RCOM
driver
nmb a2200000Iu 4500
"171001 2017 eng "
2348-1900
dc
Traditional medicinal plant knowledge of some spermatophytes of Samar Bagh Valley, Lower Dir District, Pakistan
Irfan, Muhammad
Abdulwali khan university mardan, pakistan
Ahmad, Imran
Hazara university Mansehra, Pakistan
Saeed, Sidra Hassan
Hazara university Mansehra, Pakistan
The study on traditional knowledge of medicinal plants which are used by local people of Samar Bagh valley in district Lower Dir, Pakistan resulted in the report of 41 species of seed plants which belong to 37 genera and 30 families. Amongst them are 55% herbs, 25% shrubs, 17 % trees and 3% rhizome bearing species. The local peoples who use these plants for the treatment of various diseases were farmers, those who are raring of live stock and hakims.
Horizon e-Publishing Group
2017-10-01 02:52:05
Peer-reviewed Article
application/pdf
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/334
Plant Science Today; Vol. 4 No. 4 (2017)
eng
Copyright (c) 2017 Muhammad Irfan, Imran Ahmad, Sidra Hassan Saeed
oai:ojs.horizonepublishing.com:article/364
2020-08-01T06:41:02Z
PST:RCOM
driver
nmb a2200000Iu 4500
"180102 2018 eng "
2348-1900
dc
Genus Symphysodontella M. Fleisch. (Pterobryaceae: Bryophyta) - new to the moss flora of the Eastern Ghats
Daniels, Albert Ebenezer Dulip
Bryology Laboratory, Department of Botany & Research Centre, Scott Christian College (Autonomous), Nagercoil - 629 003, India
Preetha, M M
Bryology Laboratory, Department of Botany & Research Centre, Scott Christian College (Autonomous), Nagercoil - 629 003, India
Asha, V
Bryology Laboratory, Department of Botany & Research Centre, Scott Christian College (Autonomous), Nagercoil - 629 003, India
Biju, P M
Bryology Laboratory, Department of Botany & Research Centre, Scott Christian College (Autonomous), Nagercoil - 629 003, India
Surveys carried out in the Kolli Hills of Eastern Ghats resulted in the discovery of 2 species of Symphysodontella M. Fleisch. namely S. cylindracea (Mont.) M. Fleisch. and S. involuta (Thwaites & Mitt.) M. Fleisch. of which the former is new to the moss flora of India whereas the latter is new to the moss flora of Eastern Ghats. Detailed descriptions with figures substantiated by photo plates and a key to distinguish the two species are provided. Incidentally, genus Symphysodontella is new to the moss flora of Eastern Ghats.
Horizon e-Publishing Group
2018-01-01 05:35:38
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/364
Plant Science Today; Vol. 5 No. 1 (2018)
eng
Copyright (c) 2018 Albert Ebenezer Dulip Daniels, M M Preetha, V Asha, P M Biju
oai:ojs.horizonepublishing.com:article/367
2020-08-01T06:41:00Z
PST:RCOM
driver
nmb a2200000Iu 4500
"180205 2018 eng "
2348-1900
dc
New distribution record of a rare taxa Gottschelia schizopleura (Spruce) Grolle, of Jungermanniales occurring in Anamudi shola National Park in the Western Ghats of Kerala
Mufeed, B
PG & Research Department of Botany, The Zamorin’s Guruvayurappan College, Kerala- 673014, India
Nair, Manju C
PG & Research Department of Botany, The Zamorin’s Guruvayurappan College, Kerala- 673014, India
A rare liverwort Gottschelia schizopleura (Spruce) Grolle, of Jungermanniales is discovered from the Western Ghats of Kerala. A brief description with colour plate is provided.
Horizon e-Publishing Group
2018-01-01 05:35:38
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/367
Plant Science Today; Vol. 5 No. 1 (2018)
eng
Copyright (c) 2018 B Mufeed, Manju C Nair
oai:ojs.horizonepublishing.com:article/377
2020-08-01T06:40:56Z
PST:RCOM
driver
nmb a2200000Iu 4500
"180425 2018 eng "
2348-1900
dc
Genus Notoscyphus Mitt. - New to the liverwort flora of the Eastern Ghats
Daniels, Albert Ebenezer Dulip
Bryology Laboratory, Department of Botany & Research Centre, Scott Christian College (Autonomous), Nagercoil 629 003, India
Preetha, M M
Bryology Laboratory, Department of Botany & Research Centre, Scott Christian College (Autonomous), Nagercoil 629 003, India
Asha, V
Bryology Laboratory, Department of Botany & Research Centre, Scott Christian College (Autonomous), Nagercoil 629 003, India
Monisha, P
Bryology Laboratory, Department of Botany & Research Centre, Scott Christian College (Autonomous), Nagercoil 629 003, India
Biju, P M
Bryology Laboratory, Department of Botany & Research Centre, Scott Christian College (Autonomous), Nagercoil 629 003, India
Notoscyphus paroicus Schiffn. has been discovered in the Kolli Hills of Eastern Ghats. The genus is new to the liverwort flora of this region. A brief description with figures and photo plate is provided.
Horizon e-Publishing Group
2018-04-01 03:18:19
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/377
Plant Science Today; Vol. 5 No. 2 (2018)
eng
Copyright (c) 2018 A E D Daniels, M M Preetha, V Asha, P Monisha, P M Biju
oai:ojs.horizonepublishing.com:article/379
2020-08-01T06:40:57Z
PST:RCOM
driver
nmb a2200000Iu 4500
"180405 2018 eng "
2348-1900
dc
Ethnobotanical survey of the flora of Maidan Valley, Lower Dir District, Khyber Pakhtunkhwa Province, Pakistan
Irfan, Muhammad
Department of Botany, Abdulwalikhan University, Mardan, Pakistan
Ali, Izaz
Department of Botany, Hazara University, Mansehra, Pakistan
Kashif, Rabia Afza
Department of Botany, Hazara University, Mansehra, Pakistan
An ethnomedicinal survey of the plants of Maidan Valley, Lower Dir District, Khyber Pakhtunkhwa Province, Pakistan was carried out to collect and document the information available with the local people. A total of 43 ethnomedicinal taxa were identified, that were distributed among 40 genera and 31 families and utilized by the local people for the treatment of various ailments. Amongst them thirty eight taxa were Angiosperms that included thirty four Dicotyledons and four Monocotyledons. The remaining five taxa comprised of two Pteridophytes, two Gymnosperms and one Fungus. Lamiaceae was the largest family with seven taxa, Apiaceae, the second largest family with three taxa followed by Amaranthaceae, Berberidaceae, Rhamnaceae, Rutaceae and Violaceae having two taxa each. The remaining families viz. Anacardiaceae, Asteraceae, Buxaceae, Canabiaceae, Cucurbitaceae, Euphorbiaceae, Fagaceae, Fumariaceae, Geraniaceae, Juglandaceae, Liliaceae, Morchellaceae, Oleaceae, Papaveraceae, Papilionaceae, Punicaceae Rosaceae, Saxifragaceae and Solanaceae had one taxa each of ethnobotanical importance.. They were mostly used in the form of dicoctions and infusionsas remedies against respiratory diseases viz. asthma, bronchitis, emphysema and pneumonia, kidney and urinary problems, circulatory disorders and skin diseases.
Horizon e-Publishing Group
2018-04-01 03:18:19
Peer-reviewed Article
application/pdf
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/379
Plant Science Today; Vol. 5 No. 2 (2018)
eng
Copyright (c) 2018 Muhammad Irfan, Izaz Ali, Rabia Afza
oai:ojs.horizonepublishing.com:article/397
2020-08-01T06:40:54Z
PST:RCOM
driver
nmb a2200000Iu 4500
"180717 2018 eng "
2348-1900
dc
Larvicidal activity of essential oil of Etlingera fenzlii (Kurz) Skronick. & M. Sabu (Zingiberaceae) - The honey bee repellent endemic plant species of the Andaman Nicobar Islands
Anju, S
JNTBGRI, Palode, Thiruvananthapuram 695562, Kerala, India
Aneesh, E M
Communicable Disease Research Laboratory, St. Joseph’s College, Irinjalakuda, Thrissur 680121, India
Radha, R K
JNTBGRI, Palode, Thiruvananthapuram 695562, Kerala, India
Etlingera fenzlii (Kurz) Skronick. & M. Sabu (Zingiberaceae), is an endemic species of the Andaman Nicobar Islands which is exclusively used by the Shompens as a bee repellent for honey collection. The essential oil obtained by hydrodistillation of leaves of E. fenzlii and the volatile constituents of leaves have proved to be effective eco-friendly and possess varying degrees of insect/ pest controlling properties. The present study was focussed on the role of larvicidal activities of the essential oil of E. fenzlii against Aedes aegypti. Larvicidal study was carried out employing WHO standard method and the mortality was observed after 24 h exposure. Larvicidal tests were carried out with the essential oil concentration ranges from 5-50 ppm. Essential oil treatment had higher mortality as compared to control with LC50 value of 11.22 ppm. From the results, it is evident that E. fenzlii can be considered as effective larvicide, signifying an ecofriendly method for the control of mosquito vectors.
Horizon e-Publishing Group
2018-07-01 00:00:00
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/397
Plant Science Today; Vol. 5 No. 3 (2018)
eng
Copyright (c) 2018 Anju S, Aneesh EM, Radha RK
oai:ojs.horizonepublishing.com:article/400
2020-08-01T06:40:53Z
PST:RCOM
driver
nmb a2200000Iu 4500
"180730 2018 eng "
2348-1900
dc
The moss Cyathophorum hookerianum (Griff.) Mitt. - new to Peninsular India from the Eastern Ghats
Daniels, A E D
Bryology Laboratory, Department of Botany & Research Centre, Scott Christian College (Autonomous), Nagercoil 629003, India
Monisha, P
Bryology Laboratory, Department of Botany & Research Centre, Scott Christian College (Autonomous), Nagercoil 629003, India
Preetha, M M
Bryology Laboratory, Department of Botany & Research Centre, Scott Christian College (Autonomous), Nagercoil 629003, India
Asha, V
Bryology Laboratory, Department of Botany & Research Centre, Scott Christian College (Autonomous), Nagercoil 629003, India
Biju, P M
Bryology Laboratory, Department of Botany & Research Centre, Scott Christian College (Autonomous), Nagercoil 629003, India
Surveys carried out in the Kolli Hills of Eastern Ghats led to the discovery of Cyathophorum hookerianum (Griff.) Mitt. which is new to Peninsular India. On the other hand, the genus Cyathophorum P. Beauv. is new to the moss flora of the Eastern Ghats. A detailed description with illustrations and microphotographs are provided.
Horizon e-Publishing Group
2018-07-01 00:00:00
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/400
Plant Science Today; Vol. 5 No. 3 (2018)
eng
Copyright (c) 2018 A E D Daniels, P Monisha, M M Preetha, V Asha, P M Biju
oai:ojs.horizonepublishing.com:article/413
2020-08-01T06:40:52Z
PST:RCOM
driver
nmb a2200000Iu 4500
"180902 2018 eng "
2348-1900
dc
Assessment of diurnal variation in Ocimum sanctum Linn. by gas chromatographic fingerprint analysis coupled with chemometric methods
Patel, Nikunj
K.B. Institute of Pharmaceutical Education and Research, Kadi Sarva Vishwavidyalaya, Gandhinagar – 382023, Gujarat, India
Kanaki, Niranjan
K.B. Institute of Pharmaceutical Education and Research, Kadi Sarva Vishwavidyalaya, Gandhinagar – 382023, Gujarat, India
Movaliya, Vinit
K.B. Institute of Pharmaceutical Education and Research, Kadi Sarva Vishwavidyalaya, Gandhinagar – 382023, Gujarat, India
Vast intra-specific variations, especially diurnal, geographical and seasonal, have been reported in the chemical composition of essential oils of Ocimum species. The study was conducted to assess diurnal variation in the chemical composition of the leaves of Ocimum sanctum. The leaf samples collected at different times of the day were analyzed by gas chromatography coupled with flame ionization detector (GC-FID). The chromatographic fingerprints of different leaf samples were analyzed by chemometric methods like principal component analysis and hierarchical cluster analysis. No significant difference was found in the chemical compositions of the leaf samples collected at different times of the day. The results lead to a conclusion that O. sanctum does not exhibit diurnal variation in its chemical composition, unlike O. gratissimum.
Horizon e-Publishing Group
2018-07-01 00:00:00
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/413
Plant Science Today; Vol. 5 No. 3 (2018)
eng
Copyright (c) 2018 Nikund Patel, Niranjan Kanaki, Vinit Movaliya
oai:ojs.horizonepublishing.com:article/417
2020-08-01T06:40:50Z
PST:RCOM
driver
nmb a2200000Iu 4500
"181002 2018 eng "
2348-1900
dc
Two new additions to the flora of Vietnam
DANG, Son Van
Institute of Tropical Biology, Vietnam Academy of Science and Technology, Ho Chi Minh City, Vietnam
TON, Nu Thi Nhu Quynh
Hue Medical College, Vietnam
TRUONG, Thi Dep
University of Medicine and Pharmacy, Ho Chi Minh City, Vietnam
HOANG, Nghia Son
Institute of Tropical Biology, Vietnam Academy of Science and Technology, Ho Chi Minh City, Vietnam
Among the studied specimens collected from Son Tra Nature Reserve, Vietnam, two new taxa: Oxalis barrelieri L. (Oxalidaceae) and Glochidion acuminatum var. siamense Airy Shaw (Phyllanthaceae) which forms new records to the flora of Vietnam. Taxonomic description, habitat, distribution and uses, and color photographs of both taxa are provided.
Horizon e-Publishing Group
2018-10-01 11:01:53
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/417
Plant Science Today; Vol. 5 No. 4 (2018)
eng
Copyright (c) 2018 Son Van DANG, Nu Thi Nhu Quynh TON, Thi Dep TRUONG, Nghia Son HOANG
oai:ojs.horizonepublishing.com:article/421
2020-08-01T06:40:48Z
PST:RCOM
driver
nmb a2200000Iu 4500
"181112 2018 eng "
2348-1900
dc
Karyotype analysis of Solanum torvum Sw. - an ethnobotanical Solanaceous species of Tripura, North East India
Singha, H. Reshmi
Cytogenetics and Plant Biotechnology Laboratory, Department of Botany, Tripura University (A Central University) , Suryamaninagar, Tripura 799022, India
Chowdhury, Bipul Das
Cytogenetics and Plant Biotechnology Laboratory, Department of Botany, Tripura University (A Central University) , Suryamaninagar, Tripura 799022, India
Sinha, Sangram
Cytogenetics and Plant Biotechnology Laboratory, Department of Botany, Tripura University (A Central University) , Suryamaninagar, Tripura 799022, India
Sinha, Rabindra Kumar
Cytogenetics and Plant Biotechnology Laboratory, Department of Botany, Tripura University (A Central University) , Suryamaninagar, Tripura 799022, India
Solanum torvum Sw. is a wild Solanaceous plant species, commonly used by the indigenous people of Tripura. Cytological study of the species was carried out to determine the somatic chromosome number and to construct the karyotype formula. The detailed karyomorphological analysis revealed 2n=24 somatic chromosomes having haploid number n=12. The size of chromosomal complement was found to range from 2.14±0.21 to 4.02±0.26 µm with a pair of chromosomes bearing secondary constrictions. Strictly median primary constriction was recorded in two pairs of chromosomes. In general, karyotype formula was found to be A2B4C18. The detailed karyotype analysis revealed that chromosomes are generally small in size and fall under the Stebbins category of “2A” indicating symmetrical nature of the karyotype. The present study could be utilised in understanding the cytogenetic nature of the species and for future crop improvement programme.
Horizon e-Publishing Group
2018-10-01 11:01:53
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/421
Plant Science Today; Vol. 5 No. 4 (2018)
eng
Copyright (c) 2018 H R Singha, B D Chowdhury, S Sinha, R K Sinha
oai:ojs.horizonepublishing.com:article/429
2020-08-01T06:40:48Z
PST:RCOM
driver
nmb a2200000Iu 4500
"181121 2018 eng "
2348-1900
dc
Eugenia kalamii (Myrtaceae), a new species from Western Ghats, India
Shareef, Sainudeen Muhammed
JNTBGRI
Santhosh Kumar, Ettickal Sukumaran
Shaju, Thankappan
Prakashkumar, R
A new species of Eugenia L. (Myrtcaeae), viz. E. kalamii, is described and illustrated from the Western Ghats of India. It is morphologically allied to E. mooniana Wight, (Indo-Sri Lankan species) and E. wynadensis Bedd., (endemic species of southern Western Ghats).
Horizon e-Publishing Group
2018-10-01 11:01:53
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/429
Plant Science Today; Vol. 5 No. 4 (2018)
eng
Copyright (c) 2018 S M Shareef, E S Santhosh Kumar, T Shaju, R Prakashkumar
oai:ojs.horizonepublishing.com:article/431
2020-08-01T06:40:46Z
PST:RCOM
driver
nmb a2200000Iu 4500
"190112 2019 eng "
2348-1900
dc
Salvia reflexa (Lamiaceae): a new record for Pakistan
Hussain, Wahid
Department of Botany, Government Post Graduate College, Parachinar, Pakistan
Badshah, Lal
Phytoecology Lab., Department of Botany, University of Peshawar, 25000, Pakistan
Shah, Sayed Afzal
Department of Plant Sciences, Quaid-i-Azam University, Islamabad, Pakistan
Hussain, Farrukh
Institute of Biological Science, Sarhad University of Science and Technology, Peshawar, Pakistan
Ali, Asghar
Department of Botany, Government AKL Post Graduate College, Matta, Swat, Pakistan
Shah, Shamim-ul-Sibtain
Farm Operations & Services, National Agricultural Research Centre, Park Road, Islamabad, Pakistan
Sultan, Amir
National Herbarium (Stewart Collection), National Agricultural Research Centre, Park Road, Islamabad, Pakistan
Salvia reflexa Hornem., a member of the New World subgenus Calosphace, ranges from North America to southern South America, Australia, New Zealand, South Africa and Afghanistan in Asia, and still continues to expand its range. Here we report further range expansion for S. reflexa into the tribal areas of Pakistan and hypothesize that it has been introduced from Afghanistan. This represents a new record for the flora of Pakistan.
Horizon e-Publishing Group
2019-01-01 07:18:04
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/431
Plant Science Today; Vol. 6 No. 1 (2019)
eng
Copyright (c) 2019 Wahid Hussain, Lal Badshah, Sayed Afzal Shah, Farrukh Hussain, Asghar Ali, Shamim-ul-Sibtain Shah, Amir Sultan
oai:ojs.horizonepublishing.com:article/432
2020-08-01T06:40:47Z
PST:RCOM
driver
nmb a2200000Iu 4500
"181126 2018 eng "
2348-1900
dc
Pterobryopsis kegeliana (Müll. Hal.) M. Fleisch. and P. scabriuscula (Mitt.) M. Fleisch. - new to the moss flora of the Eastern Ghats
Dulip Daniels, A E
Scott Christian College (Autonomous)
Biju, P M
Bryology Laboratory, Department of Botany and Research Centre, Scott Christian College (Autonomous), Nagercoil-629 003, India (Affiliated to Manonmaniam Sundaranar University, Tirunelveli)
Asha, V
Bryology Laboratory, Department of Botany and Research Centre, Scott Christian College (Autonomous), Nagercoil-629 003, India (Affiliated to Manonmaniam Sundaranar University, Tirunelveli)
Pterobryopsis kegeliana (Müll. Hal.) M. Fleisch., so far known from Pachmarhi and the Western Ghats in India, and P. scabriuscula (Mitt.) M. Fleisch., known from the Western Ghats, Sri Lanka and Thailand (?), are recorded for the first time in the Eastern Ghats. A perusal of literature revealed that Meteorium scabriusculum Mitt., the holotype of P. scabriuscula, collected by Law from Concan, presumed to be a place in Thailand by Noguchi refers to only the present-day Konkan region in Peninsular India. Hence, the distribution of P. scabriuscula is amended here. Detailed descriptions with figures and photographic plates are provided.
Horizon e-Publishing Group
2018-10-01 11:01:53
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/432
Plant Science Today; Vol. 5 No. 4 (2018)
eng
Copyright (c) 2018 A E Dulip Daniels, P M Biju, V Asha
oai:ojs.horizonepublishing.com:article/450
2020-08-01T06:40:45Z
PST:RCOM
driver
nmb a2200000Iu 4500
"190120 2019 eng "
2348-1900
dc
Taxonomy and Distribution of Scleria foliosa (Cyperaceae) in Kerala, India
Viji, A R
Department of Botany, Iqbal College, Thiruvananthapuram, Kerala, India
Preetha, T S
Department of Botany, University College, Thiruvananthapuram, Kerala, India
Scleria foliosa (Cyperaceae) an interesting sedge species is reported here as a new record for Kerala. Detailed description with photographs and relevant notes on distribution are provided for easy identification.
Horizon e-Publishing Group
2019-01-01 07:18:04
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/450
Plant Science Today; Vol. 6 No. 1 (2019)
eng
Copyright (c) 2019 A R Viji, T S Preetha
oai:ojs.horizonepublishing.com:article/464
2020-08-01T06:40:44Z
PST:RCOM
driver
nmb a2200000Iu 4500
"190122 2019 eng "
2348-1900
dc
Lectotypification of the basionym and a synonym of Givotia moluccana (Euphorbiaceae) ensuring its unambiguous use
Chakrabarty, T
Botanical Survey of India, Kolkatha (Retd). Present address: 4, Botanical Garden Lane, Howrah 711103, West Bengal, India
Krishna, G
Central National Herbarium, Botanical Survey of India, Botanic Garden, Howrah 711103, India
A second-step lectotype is designated for the Linnaean name Croton moluccanus ensuring its unambiguous use as Givotia moluccana (L.) Sreem., for a species treated in most of the Indian and Ceylonese Floras as Givotia rottleriformis Griff. ex Wight. A lectotype is also designated for the synonym G. rottleriformis as the earlier lectotypification of this name was not based on the original material used for describing the species.
Horizon e-Publishing Group
2019-01-01 07:18:04
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/464
Plant Science Today; Vol. 6 No. 1 (2019)
eng
Copyright (c) 2019 T Chakrabarty, G Krishna
oai:ojs.horizonepublishing.com:article/490
2020-08-01T06:40:37Z
PST:RCOM
driver
nmb a2200000Iu 4500
"190427 2019 eng "
2348-1900
dc
A report on new chromosome number of three Dioscorea species
Paul, Chiranjit
Plant Diversity and Forest Biotechnology Laboratory, Department of Forestry and Biodiversity, Tripura University, Suryamaninagar 799022, India
Debnath, Bimal
Plant Diversity and Forest Biotechnology Laboratory, Department of Forestry and Biodiversity, Tripura University, Suryamaninagar 799022, India
Chromosomal study conducted in nine species of Dioscorea from different forest belts of Tripura revealed that their somatic chromosome number ranged from 2n=40 to 2n=60. The record of 2n=40 chromosome in the sexual phenotypes of Dioscorea hamiltonii, Dioscorea glabra and Dioscorea pubera are the first time report from Tripura, North East India. Moreover the somatic chromosome counts of 2n=60 in Dioscorea pentaphylla would be attributed as a new cytotype. However at the respective ploidy level no difference in somatic chromosome count was observed between their sexes.
Horizon e-Publishing Group
2019-04-01 09:25:12
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/490
Plant Science Today; Vol. 6 No. 2 (2019)
eng
Copyright (c) 2019 Chiranjit Paul, Bimal Debnath
oai:ojs.horizonepublishing.com:article/491
2020-08-01T06:40:39Z
PST:RCOM
driver
nmb a2200000Iu 4500
"190401 2019 eng "
2348-1900
dc
Effect of organic amendments on soil salinity and the growth of maize (Zea mays L.)
Khatun, Monowara
Soil, Water & Environment Discipline, Khulna University, Khulna, Bangladesh
Shuvo, Md. Asif Rehan
Soil, Water & Environment Discipline, Khulna University, Khulna, Bangladesh
Salam, Md. Tareq Bin
Soil, Water & Environment Discipline, Khulna University, Khulna, Bangladesh
Rahman, S.M. Hafizur
Faculty of Agriculture, Bangladesh Agricultural University, Mymenshing, Bangladesh
Soil salinity is a major concern in southwestern part of Bangladesh because almost 30% cultivable lands are currently lying under risk of salinity where 30-50% yields loss is happening. Organic amendments have found to be effective in the amelioration of saline soil by improving soil physical and chemical properties as well as crop selection is another criteria for sustaining viability of crops in saline soil. For ensuring sustainable saline soil management, a comparative pot study was carried out during kharif 1 season in 2015 to observe the effect of organic amendments (solid waste, vermicompost and cow dung) on soil salinity and its influence on the growth of maize. Composite soil was collected at a depth of 0-15 cm from Gozalmari village of Jalma Union in Batiaghata Upazila under Khulna district, Bangladesh that was saline (10.6 dS/m) in nature and the irrigation water sample was collected from beside Kazibacha river (4.28 dS/m) that was also moderately saline. The maize cultivar “Shuvra” was used for cultivation in the study. The experiment comprised of four treatments viz. T0: Control (No organic manure); T1: Solid waste (36g); T2: Vemicompost (72g); T3: Cow dung (33g). Five seeds were sown in each pot. Seeds were treated with Agrosan GN to protect them from seed and soil borne pathogens. Chemical fertilizers were not used in the experiment. Irrigation was done two times before harvesting: at 20 days after sowing (DAS) and at 40 DAS with river water and rain water was irrigated naturally during the season. Findings were that the organic amendments significantly influence the physico-chemical properties of the saline soil. All organic treated soils significantly reduce the soil EC (from 10.6 dS/m to 3.4 dS/m) and pH (from 7.63 to 7.38) compared to control soil (p?0.05). In case of survival parameters (e.g %gemination, rate of survival at 50 DAS) of maize, the treatments were found insignificant (p?0.05). But in terms of growth parameter (plant height and root length), significant differences were found between control and organic amendments treated soil (p?0.05). It may be concluded that organic amendments treated soils showed better results than that of control soil. If proper management can be implemented, this positive results will bring hope to the local poor farmers at least can introduce a new crop in fallow agricultural land during the kharif 1 season.
Horizon e-Publishing Group
2019-04-01 09:25:12
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/491
Plant Science Today; Vol. 6 No. 2 (2019)
eng
Copyright (c) 2019 Monowara Khatun, Md. Asif Rehan Shuvo, Md. Tareq Bin Salam, S.M. Hafizur Rahman
oai:ojs.horizonepublishing.com:article/494
2020-08-01T06:40:39Z
PST:RCOM
driver
nmb a2200000Iu 4500
"190401 2019 eng "
2348-1900
dc
Revisiting the typification of Hemicyclia porteri (Putranjivaceae), the basionym of Drypetes porteri
Chakrabarty, Tapas
Botanical Survey of India
Bandyopadhyay, S.
Botanical Survey of India
Krishna, G.
Botanical Survey of India
Hemicyclia porteri Gamble, the basionym of Drypetes porteri (Gamble) Pax & K. Hoffm. was lectotypified three times by different authors differently. This paper unambiguously elucidates the precise designation of lectotype for the name, and also emphasizes the need of exerting utmost care while designating a lectotype.
Horizon e-Publishing Group
2019-04-01 09:25:12
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/494
Plant Science Today; Vol. 6 No. 2 (2019)
eng
Copyright (c) 2019 Tapas Chakrabarty, S. Bandyopadhyay, G. Krishna
oai:ojs.horizonepublishing.com:article/539
2020-08-01T06:40:30Z
PST:RCOM
driver
nmb a2200000Iu 4500
"190701 2019 eng "
2348-1900
dc
Taxonomic notes on Indian Terminalia (Combretaceae)
Chakrabarty, Tapas
4, Botanical Garden Lane, Howrah 711 103, India
Krishna, G.
Central National Herbarium, Botanical Survey of India, AJC Bose Indian Botanic Garden, Howrah 711 103, India
Rasingam, L.
Botanical Survey of India, Deccan Regional Centre, Attapur, Hyderabad 500 048, India
The species Terminalia kanchii Dhabe, T. manii King, T. maoi Dhabe and T. shankarraoi Dhabe were identified to be conspecific with T. citrina (Gaertn.) Roxb. and therefore reduced to synonyms of the latter. Terminalia procera Roxb., treated recently as a synonym of T. catappa L. is reinstated here as a distinct species, and for the name, a lectotype and an epitype have been designated and T. copelandii Elmer is considered as its synonym. Terminalia tomentosa (Roxb. ex DC.) Wight & Arn., which has recently been recognized as a distinct species, is treated as a synonym of T. elliptica Willd. Terminaila sharmae M.Gangop. & Chakrab. is merged with Elaeocarpus rugosus Roxb. ex G. Don of the Elaeocarpaceae, and a lectotype has been designated for the latter name. Terminalia vermae M.Gangop. & Chakrab. is maintained as a distinct species.
Horizon e-Publishing Group
2019-07-01 08:22:55
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/539
Plant Science Today; Vol. 6 No. 3 (2019)
eng
Copyright (c) 2019 T Chakrabarty, G Krishna, L Rasingam
oai:ojs.horizonepublishing.com:article/541
2020-08-01T06:40:27Z
PST:RCOM
driver
nmb a2200000Iu 4500
"190728 2019 eng "
2348-1900
dc
On the identity and occurrence of Rubus racemosus (Rosaceae) in India with note on its neotypification
Bhavadas, N
Research and Development Centre, Bharathiar University, Coimbatore 641 046, Tamil Nadu, India
Prabhukumar, K M
Centre for Medicinal Plants Research, Arya Vaidya Sala, Kottakkal, Malappuram 676 503, Kerala, India
Umesh, B T
Department of Bioscience, MES college, Marampally, Aluva, Kerala 683 107, India
Rubus racemosus is an endemic species of Rosaceae and the distribution is strictly restricted to southern parts of the Western Ghats. The present paper provides a detailed taxonomic description, colour photographs and discusses the taxonomic affinity of the taxon with its allied taxa. And also, the name Rubus racemosus is neotypified here.
Horizon e-Publishing Group
2019-07-01 08:22:55
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/541
Plant Science Today; Vol. 6 No. 3 (2019)
eng
Copyright (c) 2019 N Bhavadas, K M Prabhukumar, B T Umesh
oai:ojs.horizonepublishing.com:article/556
2020-08-01T06:40:32Z
PST:RCOM
driver
nmb a2200000Iu 4500
"190602 2019 eng "
2348-1900
dc
Chemical composition of Hedychium coronarium Koen. flowers from eastern India
Parida, Reena
Centre for Biotechnology, Siksha ‘O’ Anusandhan University, Kalinga Nagar, Ghatikia, Bhubaneswar- 751 003, Odisha, India http://orcid.org/0000-0001-8059-8417
Nayak, Sanghamitra
Centre for Biotechnology, Siksha ‘O’ Anusandhan University, Kalinga Nagar, Ghatikia, Bhubaneswar- 751 003, Odisha, India
In this study essential oil from both conventional and micropropagated flowers of Hedychium coronarium were extracted through hydro-distillation process and its chemical composition were analyzed by gas chromatography and mass spectrometry. A total of 11 compounds were identified from conventionally grown plants where as 7 compounds were identified in micropropagated plants. The major compound identified in conventional and micropropagated plantlets is eucalyptol (18.04 % and 26.47 %) respectively. The medicinally beneficial compounds present in the oil confirm the plant to be curative for various diseases in human and valuable for commercial purposes.
Horizon e-Publishing Group
2019-04-01 09:25:12
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/556
Plant Science Today; Vol. 6 No. 2 (2019)
eng
Copyright (c) 2019 Reena Parida, Sanghamitra Nayak
oai:ojs.horizonepublishing.com:article/574
2020-08-01T06:40:24Z
PST:RCOM
driver
nmb a2200000Iu 4500
"191001 2019 eng "
2348-1900
dc
Staurochilus ramosus (Lindl.) Seidenf (Orchidaceae): an addition to the flora of Tripura
Baishnab, Biswajit
Plant Taxonomy & Biodiversity Laboratory, Department of Botany, Tripura University, Suryamaninagar 799 022, Tripura, India
Chowdhury, Ashish Kumar
Plant Taxonomy & Biodiversity Laboratory, Department of Botany, Tripura University, Suryamaninagar 799 022, Tripura, India
Datta, Badal Kumar
Plant Taxonomy & Biodiversity Laboratory, Department of Botany, Tripura University, Suryamaninagar 799 022, Tripura, India
In this study we have included a monopodial epiphytic orchid, Staurochilus ramosus (Lindl.) Seidenf. to the flora of Tripura, for the first time. This article deals with a little bit of genus description, geographical location, phenology and taxonomic enumeration supported by suitable photo flyer.
Horizon e-Publishing Group
2019-10-01 10:05:11
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/574
Plant Science Today; Vol. 6 No. 4 (2019)
eng
Copyright (c) 2019 Biswajit Baishnab, Ashish Kumar Chowdhury, Badal Kumar Datta
oai:ojs.horizonepublishing.com:article/579
2020-08-01T06:40:23Z
PST:RCOM
driver
nmb a2200000Iu 4500
"191001 2019 eng "
2348-1900
dc
Notes on the typification of three names in Indian Ranunculus L. (Ranunculaceae)
Kumar, Anand
Central National Herbarium, Botanical Survey of India, P.O. Botanic Garden, Howrah 711 103, India
Maurya, Onkar Nath
Botanical Survey of India, CGO Complex, Salt Lake City, Kolkata 700 064, India
The erroneous designation of holotype and lectotype of three names in Ranunculus namely R. reniformis Wall. ex Wight & Arn., R. subpinnatus Wight & Arn. and R. wallichianus Wight & Arn. in one of the recent publications is discussed here. This paper also emphasizes the precise application of the phrase typification of the name and also rectifies here the erroneous designation of holotype and lectotype of names in a recent publication.
Horizon e-Publishing Group
2019-10-01 10:05:11
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/579
Plant Science Today; Vol. 6 No. 4 (2019)
eng
Copyright (c) 2019 Anand Kumar, Onkar Nath Maurya
oai:ojs.horizonepublishing.com:article/597
2020-08-01T06:40:21Z
PST:RCOM
driver
nmb a2200000Iu 4500
"191001 2019 eng "
2348-1900
dc
The moss genus Regmatodon Brid. (Regmatodontaceae) - new to the Eastern Ghats
Dulip Daniels, A E
Bryology Laboratory, Department of Botany and Research Centre, Scott Christian College (Autonomous), Nagercoil 629 003, India
Biju, P M
Bryology Laboratory, Department of Botany and Research Centre, Scott Christian College (Autonomous), Nagercoil 629 003, India
Asha, V
Bryology Laboratory, Department of Botany and Research Centre, Scott Christian College (Autonomous), Nagercoil 629 003, India
Regmatodon orthostegius Mont. was earlier reported from Central India, the Himalaya, Northeast India and the Western Ghats in India. However, while collecting bryophytes from the Eastern Ghats, the authors came across a moss which was later identified as Regmatodon orthostegius which is a new distributional record for this genus as well. A detailed description with figure and photographic plates is provided.
Horizon e-Publishing Group
2019-10-01 10:05:11
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/597
Plant Science Today; Vol. 6 No. 4 (2019)
eng
Copyright (c) 2019 A E Dulip Daniels, P M Biju, V Asha
oai:ojs.horizonepublishing.com:article/626
2020-08-01T06:40:10Z
PST:RCOM
driver
nmb a2200000Iu 4500
"200101 2020 eng "
2348-1900
dc
Taxonomic notes on the identity of Rungia latior var. anamalayana (Acanthaceae) from Western Ghats, India
Nazarudeen, A
Jawaharlal Nehru Tropical Botanic Garden and Research Institute, Palode, Thiruvananthapuram 695 562, Kerala, India
Rajkumar, G
Jawaharlal Nehru Tropical Botanic Garden and Research Institute, Palode, Thiruvananthapuram 695 562, Kerala, India
Mohan, Rohith Mathew
Jawaharlal Nehru Tropical Botanic Garden and Research Institute, Palode, Thiruvananthapuram 695 562, Kerala, India
Prakashkumar, R
Jawaharlal Nehru Tropical Botanic Garden and Research Institute, Palode, Thiruvananthapuram 695 562, Kerala, India
Rungia latior Nees var. anamalayana Chandrab. & V. Chandras., examined as part of the revisionary studies on the Acanthaceae of Western Ghats, have shown some taxonomic ambiguity. As the original authors rightly pointed out, the variety ‘does not fit within the circumscription of the typical species’. Based on our recent collections, we also felt that the varietal status is superfluous as the same has got some merits to be recognized as a distinct species. As such the status of the variety has been reassessed; elevated to the specific rank and a new combination has been set, conserving the varietal name as the specific epithet. Accordingly, the species is renamed as Rungia anamalayana (Chandrab. & V. Chandras.) A. Nazarudeen & G. Rajkumar comb. et stat. nov. The distinctive features and alliance of the species is discussed and a full account of the species is presented with illustrations.
Horizon e-Publishing Group
2020-01-01 19:17:50
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/626
Plant Science Today; Vol. 7 No. 1 (2020)
eng
Copyright (c) 2020 A Nazarudeen, G Rajkumar, Rohith Mathew Mohan, R Prakashkumar
oai:ojs.horizonepublishing.com:article/647
2020-08-01T06:40:03Z
PST:RCOM
driver
nmb a2200000Iu 4500
"200401 2020 eng "
2348-1900
dc
A study on some taxa of family Mniaceae (Bryophyta) in Darjeeling (West Bengal), India
Omar, Ichha
Bryology Laboratory, CSIR–National Botanical Research Institute, Lucknow 226 001, India
Sahu, Vinay
Bryology Laboratory, CSIR–National Botanical Research Institute, Lucknow 226 001, India
Asthana, Ashish Kumar
Bryology Laboratory, CSIR–National Botanical Research Institute, Lucknow 226 001, India
During study on the family Mniaceae in Darjeeling and its neighbouring areas, three genera and six species (Mnium lycopodioides, Orthomnion bryoides, Plagiomnium acutum, P. confertidens, P. rhynchophorum and P. succulentum) have been identified. Of these Plagiomnium acutum is reported here for the first time from eastern Himalaya. A detailed morpho-taxonomic account of these species with their current status and a key to all the taxa of family Mniaceae in Darjeeling is provided here.
Horizon e-Publishing Group
2020-04-01 00:00:00
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/647
Plant Science Today; Vol. 7 No. 2 (2020)
eng
Copyright (c) 2020 Ichha Omar, Vinay Sahu, Ashish Kumar Asthana
oai:ojs.horizonepublishing.com:article/664
2020-08-01T06:40:05Z
PST:RCOM
driver
nmb a2200000Iu 4500
"200401 2020 eng "
2348-1900
dc
Antioxidant properties of BJRI vegetable mesta-1 (Hibiscus sabdariffa L.)
Mollah, Md. Abul Fazal
Bangladesh Jute Research Institute, Manik Mia Avenue, Dhaka 1207, Bangladesh
Tareq, Md. Zablul
Bangladesh Jute Research Institute, Manik Mia Avenue, Dhaka 1207, Bangladesh
Bashar, Kazi Khayrul
Bangladesh Jute Research Institute, Manik Mia Avenue, Dhaka 1207, Bangladesh
Hoque, A. B. M. Zahidul
Bangladesh Jute Research Institute, Manik Mia Avenue, Dhaka 1207, Bangladesh
Karim, Md. Meftahul
Bangladesh Jute Research Institute, Manik Mia Avenue, Dhaka 1207, Bangladesh
Zahid-Al-Rafiq, Md.
Bangladesh Jute Research Institute, Manik Mia Avenue, Dhaka 1207, Bangladesh
Roselle or Mesta (Hibiscus sabdariffa) is one of the plants whose plant parts are used to prepare juices. The Roselle calyx is considered as a good source of antioxidants. But the antioxidant properties of BJRI (Bangladesh Jute Research Institute) released Roselle vegetable variety, BJRI vegetable mesta-1, is not quantified yet. With the objective of making this vegetable more popular among the consumers, an experiment was conducted at the Jute Agriculture Experimental Station, Bangladesh Jute Research Institute, Jagir, Manikganj to find out the antioxidant properties of BJRI vegetable mesta-1. Total four antioxidant components eg., total phenol content, total flavonoid content, proanthocyanidin content, anthocyanin content and three antioxidant activities eg., DPPH (1,1-diphenyl-2-picrylhydrazyl) radical scavenging, (FRAP) ferric ion reducing antioxidant power, H2O2 (hydrogen peroxide), radical scavenging were measured from the calyx sample of BJRI vegetable mesta-1. Among the four antioxidant components, total flavonoid contents (959.53 mg 100 g–1) posses the highest position and anothocyanine contents (0.17 mg 100 g–1) were in the lowest position. FRAP activities were highest among the antioxidant activities of the calyx of our studied vegetable mesta. Our findings represented the quantity of antioxidant contents of the calyx of BJRI vegetable mesta-1 which justify its uses as natural antioxidants. Thus, Roselle calyx may act as an alternative source of antioxidant rich natural herbal tea.
Horizon e-Publishing Group
2020-04-01 00:00:00
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/664
Plant Science Today; Vol. 7 No. 2 (2020)
eng
Copyright (c) 2020 Md. Abul Fazal Mollah, Md. Zablul Tareq, Kazi Khayrul Bashar, A. B. M. Zahidul Hoque, Md. Meftahul Karim, Md. Zahid-Al-Rafiq
oai:ojs.horizonepublishing.com:article/700
2020-08-01T06:40:04Z
PST:RCOM
driver
nmb a2200000Iu 4500
"200401 2020 eng "
2348-1900
dc
Recovery of Globba wengeri (C.E.C. Fisch.) K.J. Williams, critically endangered plant species from Serchhip District in Mizoram, Northeast India
mawia, Lalnun
Department of Botany, Pachhunga University College, Aizawl 796 001, India
Ralte, Vanlalhruaii
Department of Botany, Pachhunga University College, Aizawl 796 001, India
Lalruatsanga, H.
Department of Botany, Pachhunga University College, Aizawl 796 001, India
mawia, Zothan
Department of Botany, Pachhunga University College, Aizawl 796 001, India
Vanlalhluna, P.C.
Department of Botany, Pachhunga University College, Aizawl 796 001, India
Thapa, H.S.
Department of Botany, Pachhunga University College, Aizawl 796 001, India
Vanlalpeka, R.
Department of Botany, Pachhunga University College, Aizawl 796 001, India
Globba wengeri (C.E.C. Fisch.) K.J. Williams, former state flower of Mizoram, a rare and critically endangered plant species, commonly known as ‘dancing girl’, belonging to the family Zingiberaceae, is reported in this communication for the first time from Serchhip District in Mizoram at an elevation of about 1187 m a.s.l. It was found on moist, watery and rocky slopes. The plant is under severe threat in the natural habitat and therefore, further studies are required to determine life history and particular survival threats of this species.
Horizon e-Publishing Group
2020-04-01 00:00:00
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/700
Plant Science Today; Vol. 7 No. 2 (2020)
eng
Copyright (c) 2020 Lalnunmawia, Vanlalhruaii Ralte, H. Lalruatsanga, Zothanmawia, P.C. Vanlalhluna, H.S. Thapa, R. Vanlalpeka
oai:ojs.horizonepublishing.com:article/715
2020-08-01T06:40:01Z
PST:RCOM
driver
nmb a2200000Iu 4500
"200701 2020 eng "
2348-1900
dc
An overlooked new variety of Tritaxis glabella from India with a note on the consequent new synonyms of Croton lawianus (Euphorbiaceae)
Chakrabarty, Tapas
4, Botanical Garden Lane, Howrah, West Bengal 711 103, India
Krishna, Gopal
Central National Herbarium, Botanical Survey of India, Botanic Garden, Howrah 711 103, India
In connection with the taxonomic revision of the family Euphorbiaceae in India, an overlooked new variety,Tritaxis glabella (Thwaites) R.Y. Yu & Welzen var. praetervisa Chakrab. & G.Krishna, endemic to India, has been described which was going so far under misapplied names representing Croton lawianus Nimmo. Consequently, three new synonyms have been added to the latter name.
Horizon e-Publishing Group
2020-07-01 07:58:04
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/715
Plant Science Today; Vol. 7 No. 3 (2020)
eng
Copyright (c) 2020 Tapas Chakrabarty, Gopal Krishna
oai:ojs.horizonepublishing.com:article/728
2020-08-01T06:40:00Z
PST:RCOM
driver
nmb a2200000Iu 4500
"200701 2020 eng "
2348-1900
dc
A note on Thysananthus repletus (Lejeuneaceae: Marchantiophyta) with new report on asexual reproduction
Singh Deo, Siddhartha
Department of Botany, Banwarilal Bhalotia College, Asansol, West Bengal 713 303, India
Specimens of Thysananthus repletus (Taylor) Sukkharak & Gradstein are collected and described from Alipurduar District of West Bengal in Eastern Himalaya, revealing the presence of asexual reproduction by gemmae on leaf lobe as well as on androecial and gynoecial branches, which is rare for the genus and constitutes the first such report for the species. It is also first report of occurrence of the species from the state of West Bengal. Key to the Indian species of the Thysananthus subg. Mastigolejeunea is provided.
Horizon e-Publishing Group
2020-07-01 07:58:04
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/728
Plant Science Today; Vol. 7 No. 3 (2020)
eng
Copyright (c) 2020 Siddhartha Singh Deo
oai:ojs.horizonepublishing.com:article/770
2020-08-01T06:39:58Z
PST:RCOM
driver
nmb a2200000Iu 4500
"200701 2020 eng "
2348-1900
dc
The genus Eugenia L. (Myrtaceae) in India
Shareef, S M
Jawaharlal Nehru Tropical Botanic Garden & Research Institute, Palode, Karimancode P.O., Thiruvananthapuram 695 562, Kerala, India
Kumar, E S Santhosh
Jawaharlal Nehru Tropical Botanic Garden & Research Institute, Palode, Karimancode P.O., Thiruvananthapuram 695 562, Kerala, India
This paper provides a comprehensive taxonomic account of the genus Eugenia L. occurring in India. A total of 25 species and two varieties have been enumerated, of which 21 taxa are endemic to the Western Ghats. Eugenia macrosepala, an endemic species of the Western Ghats is reinstated here. Each species is provided with a short description, well known synonyms, types, distribution and phenology. An identification key is also provided.
Horizon e-Publishing Group
2020-07-01 07:58:04
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/770
Plant Science Today; Vol. 7 No. 3 (2020)
eng
Copyright (c) 2020 S M Shareef, E S Santhosh Kumar
oai:ojs.horizonepublishing.com:article/789
2020-07-23T11:31:38Z
PST:RCOM
driver
nmb a2200000Iu 4500
"200831 2020 eng "
2348-1900
dc
The genus Drepanolejeunea (Spruce) Schiffn. (Lejeuneaceae; Marchantiophyta) in the Western Ghats with special reference to Kerala
Chandini, V K
Department of Botany, Zamorin’s Guruvayurappan College (affiliated to the University of Calicut), Kozhikode 673 014, India
Mufeed, B
Department of Botany, Zamorin’s Guruvayurappan College (affiliated to the University of Calicut), Kozhikode 673 014, India
Nair, Manju C
Department of Botany, Zamorin’s Guruvayurappan College (affiliated to the University of Calicut), Kozhikode 673 014, India
Rajesh, K P
Department of Botany, Zamorin’s Guruvayurappan College (affiliated to the University of Calicut), Kozhikode 673 014, India
Diversity of the genus Drepanolejeunea (Spruce) Schiffn. of the family Lejeuneaceae in Kerala is discussed in detail. So far, 8 species have been reported from the Western Ghats, of which 6 occur in Kerala. This paper provides detailed descriptions of 5 of the species collected from Kerala during the present survey. Among these, Drepanolejeunea erecta (Steph.) Mizut. is new to the Western Ghats, D. fleischeri (Steph.) Grolle & Zhu, D. pentadactyla (Mont.) Steph. and D. ternatensis (Gottsche) Steph. are new records for Kerala.
Horizon e-Publishing Group
2020-07-01 07:58:04
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/789
Plant Science Today; Vol. 7 No. 3 (2020)
eng
Copyright (c) 2020 V K Chandini, B Mufeed, Manju C Nair, K P Rajesh
oai:ojs.horizonepublishing.com:article/798
2020-10-01T06:47:29Z
PST:RCOM
driver
nmb a2200000Iu 4500
"201001 2020 eng "
2348-1900
dc
Pathogenic complexity of septoria spot disease of wheat in northern Kazakhstan
Babkenova, Sandukash Amantaevna
LLP, Scientific-Production Center of Grain Farming named after A.I. Barayev, Kazakhstan http://orcid.org/0000-0002-3239-5575
Babkenov, Adylkhan Temirhanovich
LLP, Scientific-Production Center of Grain Farming named after A.I. Barayev, Kazakhstan http://orcid.org/0000-0002-2630-6919
Pakholkova, Elena Vasilyevna
All-Russian Research Institute of Phytopathology, Russia http://orcid.org/0000-0002-8661-6572
Kanafin, Belgibay Kamalovich
LLP, North Kazakhstan Agricultural Experimental Station, Kazakhstan http://orcid.org/0000-0002-0289-9756
Northern Kazakhstan is the main zone of spring wheat cultivation where, 85 % of the cultivated area is located. There is not a single variety resistant to Septoria spot among the varieties approved for use. The frequency of epiphytoties of wheat diseases in the northern part of Kazakhstan is four cases every ten years. During the years of epiphytotic development of brown rust and Septoria spot with the dominance of a particular disease, the yield of spring wheat is reduced by 25 % or more. Knowledge of the species composition of pathogens of Septoria spot allows a more focused approach to the study and creation of varieties of wheat resistant to this disease. The aim of the research is to study the species of Septoria spot pathogens in wheat in Northern Kazakhstan. In 2018–2019, the pathogenic complex of the causative agents of wheat Septoria spot was studied. The collection of leaves affected by Septoria spot was carried out on spring wheat varieties in the steppe, forest-steppe zones of Northern Kazakhstan. The species composition of Septoria pathogens was determined from microscopic preparations from the collected samples; which were represented by three types of septorial fungi: Septoria tritici, Stagonospora nodorum, Stagonospora avenae. In the steppe and forest-steppe zones of Northern Kazakhstan, the dominant species was S. tritici followed by S. nodorum.
Horizon e-Publishing Group
2020-10-01 00:47:29
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/798
Plant Science Today; Vol. 7 No. 4 (2020)
eng
Copyright (c) 2020 Babkenova S A, Babkenov A T, Pakholkova E V, Kanafin B K
oai:ojs.horizonepublishing.com:article/811
2020-10-01T06:47:29Z
PST:RCOM
driver
nmb a2200000Iu 4500
"201001 2020 eng "
2348-1900
dc
Karyomorphological study of Houttuynia cordata Thunb.: an ethnobotanical species of Manipuri community of Tripura, India
Guha, Anupam
Department of Botany, Rabindranath Thakur Mahavidyalaya, Bishalgarh, Sepahijala 799 102, Tripura, India http://orcid.org/0000-0001-9478-0842
Sani, Md. Rabius
Department of Botany, Rabindranath Thakur Mahavidyalaya, Bishalgarh, Sepahijala 799 102, Tripura, India http://orcid.org/0000-0002-5491-3476
Banik, Purabi
Department of Botany, Rabindranath Thakur Mahavidyalaya, Bishalgarh, Sepahijala 799 102, Tripura, India http://orcid.org/0000-0002-2917-4106
Roy, Anita
Department of Botany, Rabindranath Thakur Mahavidyalaya, Bishalgarh, Sepahijala 799 102, Tripura, India http://orcid.org/0000-0003-1395-9950
Houttuynia cordata Thunb. (Saururaceae), has the chromosome number of 2n = 112 with karyotype formula A2+B98+C12. The size of the chromosomal complement was found to range from 1.52 µm to 3.00 µm with one pair of chromosomes bearing secondary constrictions. The detailed karyotype analysis revealed that chromosomes fall under the Stebbins category of 1A, which indicating slightly asymmetric nature of chromosome. The chromosome tally and conformity of the karyotype in the present study corroborated as a new cytotype being adapted in this area, the north-eastern region of India.
Horizon e-Publishing Group
2020-10-01 00:47:29
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/811
Plant Science Today; Vol. 7 No. 4 (2020)
eng
Copyright (c) 2020 Anupam Guha, Md. Rabius Sani, Purabi Banik; Anita Roy
oai:ojs.horizonepublishing.com:article/843
2020-10-01T06:47:29Z
PST:RCOM
driver
nmb a2200000Iu 4500
"201001 2020 eng "
2348-1900
dc
The little-known Fissidens axilliflorus Thwaites & Mitt. (Fissidentaceae: Bryophyta) - new to the moss flora of India
Sreebha, R
Department of Botany, V. V. Vanniaperumal College for Women (Autonomous), Virudhunagar - 626 001, Tamil Nadu, India http://orcid.org/0000-0001-7322-9074
Daniels, A E D
Bryology Laboratory, Department of Botany & Research Centre, Scott Christian College (Autonomous), Nagercoil - 629 003, Tamil Nadu, India http://orcid.org/0000-0001-8955-2204
Fissidens axilliflorus, so far known from Sri Lanka and Laos, has been discovered in the Western Ghats in India. A description with line drawings, a photo plate and a key to distinguish F. axilliflorus from the similar F. crenulatus are provided.
Horizon e-Publishing Group
2020-10-01 00:47:29
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/843
Plant Science Today; Vol. 7 No. 4 (2020)
eng
Copyright (c) 2020 R Sreebha, A E D Daniels
oai:ojs.horizonepublishing.com:article/860
2020-10-01T06:47:29Z
PST:RCOM
driver
nmb a2200000Iu 4500
"201001 2020 eng "
2348-1900
dc
Phytoconstituents, extraction and analysis of chemical compounds of Crataegus pontica K.Koch fruit using HS-SPME and GC-MS methods
Bazgir, Nasrin
Department of Internal Medicine, School of Medicine, Ilam University of Medical Sciences, Ilam, Iran http://orcid.org/0000-0001-9635-3828
Ghaysouri, Abbas
Department of Internal Medicine, School of Medicine, Ilam University of Medical Sciences, Ilam, Iran http://orcid.org/0000-0001-5957-7144
Shakib, Pegah
Razi Herbal Medicines Research Center, Lorestan University of Medical Sciences, Khorramabad, Iran http://orcid.org/0000-0003-3525-226X
Shahsavari, Somayeh
Biotechnology and Medical Plants Research Center, Ilam University of Medical Sciences, Ilam, Iran http://orcid.org/0000-0002-3035-1042
Essential oils were extracted by HS-SPME method from the fruit of the Crataegus pontica K.Koch collected from the southern regions of Ilam province. Then, to identify chemical compounds, the essential oil was injected into a chromatograph gas device connected to a mass spectrometer (GC-MC). Of the 50 compounds identified in this essential oil, beta-Thujene (17.21%), alpha-pinene (15.40%), 2-Hexenal (12.42%), trans-Caryophyllene (8.76%), beta-Myrcene (7.89%), 1-Pentadecene (5.89%), Sabinene (4.33%) and trans-beta-Farnesene accounted for %3.50 of the major fruit essential oil compounds of C. pontica.
Horizon e-Publishing Group
2020-10-01 00:47:29
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/860
Plant Science Today; Vol. 7 No. 4 (2020)
eng
Copyright (c) 2020 Bazgir N, Ghaysouri A, Shakib P, Tahmasebi M
oai:ojs.horizonepublishing.com:article/878
2021-01-01T08:41:44Z
PST:RCOM
driver
nmb a2200000Iu 4500
"210101 2021 eng "
2348-1900
dc
An overview of the genus Dioscorea L. (Dioscoreaceae) in India
Waris, Raza
Plant Diversity, Systematics and Herbarium Division, CSIR-National Botanical Research Institute, Lucknow, 226 001, Uttar Pradesh, India
Tripathi, Shailja
Department of Botany, University of Lucknow, Lucknow, 226 007, Uttar Pradesh, India
Shukla, Amritesh Chandra
Department of Botany, University of Lucknow, Lucknow, 226 007, Uttar Pradesh, India
Agnihotri, Priyanka
Plant Diversity, Systematics and Herbarium Division, CSIR-National Botanical Research Institute, Lucknow, 226 001, Uttar Pradesh, India
The present paper depicts an overview and elucidated assessment of published data and herbarium records on the diversity, distribution pattern, endemism and threat status of Dioscorea spp. to get availed with extant stature and design strategies for its effective conservation. Dioscorea nested under family Dioscoreceae is a pantropical genus comprising about 682 species. In India, the genus is known to possess 42 taxa (41 species and one variety). Dioscorea L. is highly regarded for its nutritional and medicinal values having a significant role in pharmaceutical and nutraceutical industries. Several species of Dioscorea contain various biologically active molecules that show anti-arthritic, anti-inflammatory and anti-fertility effects and thereby known for alleviating medicinal curses.
Horizon e-Publishing Group
2021-01-01 01:41:44
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/878
Plant Science Today; Vol. 8 No. 1 (2021)
eng
Copyright (c) 2021 Raza Waris, Shailja Tripathi, Amritesh Chandra Shukla, Priyanka Agnihotri
oai:ojs.horizonepublishing.com:article/879
2020-10-01T06:47:29Z
PST:RCOM
driver
nmb a2200000Iu 4500
"201001 2020 eng "
2348-1900
dc
New species and new records of the lichen genus Buellia sensu lato (Caliciaceae) from India
Ngangom, Roshinikumar
Lichenology Laboratory, CSIR-National Botanical Research Institute, Rana Pratap Marg, Lucknow, Uttar Pradesh - 226001, India, http://orcid.org/0000-0002-1534-0951
Nayaka, Sanjeeva
Lichenology Laboratory, CSIR-National Botanical Research Institute, Rana Pratap Marg, Lucknow, Uttar Pradesh 226 001, India http://orcid.org/0000-0001-6541-2362
Gogoi, Rupjyoti
Department of Botany, Nowgong College, Nagaon, Assam 782 001, India http://orcid.org/0000-0001-9537-9460
Ingle, Komal Kumar
Lichenology Laboratory, CSIR-National Botanical Research Institute, Rana Pratap Marg, Lucknow, Uttar Pradesh 226 001, India http://orcid.org/0000-0002-0659-6031
Behera, Prashant Kumar
Lichenology Laboratory, CSIR-National Botanical Research Institute, Rana Pratap Marg, Lucknow, Uttar Pradesh 226 001, India http://orcid.org/0000-0002-0129-2135
Yasmin, Farishta
Department of Botany, Nowgong College, Nagaon, Assam 782 001, India http://orcid.org/0000-0002-2828-9307
While revising the lichen genus Buellia sensu lato from India, species Cratiria rubrum with brick red pigmented thallus is described as new to science. The new species is characterized by a red pigmented thallus, Buellia type ascospore, KOH+ red. Five species are reported for the first time from India viz., Amandinea efflorescens, A. incrustans, Baculifera orosa, Hafellia dissa and H. reagens.
Horizon e-Publishing Group
2020-10-01 00:47:29
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/879
Plant Science Today; Vol. 7 No. 4 (2020)
eng
Copyright (c) 2020 Ngangom R, Nayaka S, Gogoi R, Ingle K K, Behera P K, Yasmin F
oai:ojs.horizonepublishing.com:article/893
2020-10-01T06:47:29Z
PST:RCOM
driver
nmb a2200000Iu 4500
"201001 2020 eng "
2348-1900
dc
Influence of pineapple extract on physicochemical characteristics of cooked glutinous rice
Nguyen, Minh Phuoc Nguyen
Faculty of Biotechnology, Ho Chi Minh City Open University, Ho Chi Minh City, Vietnam http://orcid.org/0000-0001-5425-5277
Glutinous rice is an important crop in Southeast Asia. Pineapple had numerous potential to turn into added value. This research evaluated the impact of pineapple extract on physicochemical characteristics of cooked glutinous rice. The glutinous rice was soaked with pineapple extract in different percentage (0–2.5%) at ambient temperature for 12 hrs before cooking. The cooked glutinous rice was evaluated for gel consistency, water uptake ratio, volume increase ratio, cooking time and phytic acid content. Results showed that pineapple extract reduced gel consistency, cooking time, phytic acid while accelerating water uptake ratio, volume increase ratio. By incorporation of pineapple extract to glutinous rice during soaking, the physicochemical properties of cooked glutinous rice would be improved.
Horizon e-Publishing Group
2020-10-01 00:47:29
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/893
Plant Science Today; Vol. 7 No. 4 (2020)
eng
Copyright (c) 2020 Minh Phuoc Nguyen
oai:ojs.horizonepublishing.com:article/896
2020-10-01T06:47:29Z
PST:RCOM
driver
nmb a2200000Iu 4500
"201028 2020 eng "
2348-1900
dc
A new distributional record of Ficus altissima Blume (Moraceae) in Tripura: an occasionally confused fig species with Ficus benghalensis L.
Banik, Biplab
Plant Taxonomy and Biodiversity Laboratory, Department of Botany, Tripura University, Suryamaninagar 799 022, Tripura, India https://orcid.org/0000-0002-0592-710X
Debbarma, Smita
Plant Taxonomy and Biodiversity Laboratory, Department of Botany, Tripura University, Suryamaninagar 799 022, Tripura, India https://orcid.org/0000-0002-8054-0538
Majumdar, Koushik
Plant Taxonomy and Biodiversity Laboratory, Department of Botany, Tripura University, Suryamaninagar 799 022, Tripura, India https://orcid.org/0000-0002-0340-1227
Datta, Badal Kumar
Plant Taxonomy and Biodiversity Laboratory, Department of Botany, Tripura University, Suryamaninagar 799 022, Tripura, India https://orcid.org/0000-0002-5724-3324
The present communication is the first report of new distributional record of Ficus altissima Blume (Moraceae) in Tripura. F. altissima was found to be an important feeding and nesting habitat for forest frugivores, since the genus is very rich in diversity and is considered as a keystone species. This also possesses huge scope to understand the mechanism of interactions especially for conservation of rich avifaunal diversity. Brief description and field photographs are presented for facilitating easy identification of the species.
Horizon e-Publishing Group
2020-10-01 00:47:29
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/896
Plant Science Today; Vol. 7 No. 4 (2020)
eng
Copyright (c) 2020 Biplab Banik, Smita Debbarma, Koushik Majumdar, Badal Kumar Datta
oai:ojs.horizonepublishing.com:article/906
2021-08-19T05:19:12Z
PST:RCOM
driver
nmb a2200000Iu 4500
"210701 2021 eng "
2348-1900
dc
Phytochemical analysis, antioxidant and anti-inflammatory activity of leaves and bark of Ceropegia rollae Hemadri
Nayak, Shubhada S
Rayat Shikshan Sansthas, Karmaveer Bhaurao Patil College, Vashi, Navi Mumbai, MH, India https://orcid.org/0000-0002-3235-2997
Mirgane, Nitin A
SIES College of Arts, Science and Commerce, Sion (West), Mumbai 400 022, MH, India https://orcid.org/0000-0001-5413-0925
Pathade, Kisan B
Maharaja Jivajirao Shinde ASC College, Shrigonda, Dist. Ahmednagar 413 701, MH, India https://orcid.org/0000-0001-5939-2393
Shivankar, Vitthal S
Rayat Shikshan Sansthas, Chhatrapati Shivaji College, Satara, MH, India https://orcid.org/0000-0001-9684-0298
Wadhawa, Gurumeet C
Rayat Shikshan Sansthas, Karmaveer Bhaurao Patil College, Vashi, Navi Mumbai, MH, India https://orcid.org/0000-0003-1694-2708
The purpose of the present study is to evaluate in vitro antioxidant activity and anti-inflammatory activity of methanolic extract of the leaves and the bark of the plant Ceropegia rollae Hemadri. The antioxidant activity of the both leaves and bark extract was studied using FRAP and DPPH method. The in vitro anti-inflammatory activity and phytochemical characterization were carried using known protocols. The various phytochemical components such as total phenolics and flavonoids were determined. The plant Ceropegia rollae also contains tannis and ascorbic acid. This is related to the antioxidant activity of the plant Ceropegia rollae extract. The leaves shows good antioxidant and anti-inflammatory activity as compared to the bark. These can be used as natural antioxidant and anti-inflammatory agents.
Horizon e-Publishing Group
2021-07-01 03:34:22
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/906
Plant Science Today; Vol. 8 No. 3 (2021)
eng
Copyright (c) 2021 Shubhada S Nayak, Nitin A Mirgane, Kisan B Pathade, Vitthal S Shivankar, Gurumeet C Wadhawa
oai:ojs.horizonepublishing.com:article/917
2021-01-01T08:41:44Z
PST:RCOM
driver
nmb a2200000Iu 4500
"210101 2021 eng "
2348-1900
dc
Anticoagulant, fibrinogenolytic and anti-platelet aggregation activities of Lablab purpureus (L.) Sweet seed radicle aqueous extract
Thoyajakshi, R S
Department of Studies & Research in Biotechnology, Tumkur University, Tumkur, India http://orcid.org/0000-0003-1831-2996
Poornima, D
Department of Studies & Research in Biotechnology, Tumkur University, Tumkur, India http://orcid.org/0000-0001-7665-3890
The current study explores the anticoagulant, fibrinogenolytic and anti-platelet aggregation activities of Lablab purpureus (L.) Sweet seed radicle extract (LPRE). It is firstly reported that LPRE has protein at a concentration of 1.5 mg/ml and further evaluated for protein in gel electrophoresis. The proteolytic activity of LPRE was evaluated using casein and gelatin as substrate. LPRE showed a specific activity of 0.35 U. LPRE increased the plasma clotting time significantly showing its anticoagulant property. LPRE hydrolyzed the A?, B? and ? chains of fibrinogen. Furthermore, LPRE significantly inhibited the platelet aggregation induced by agonist adenosine diphosphate (ADP).
Horizon e-Publishing Group
2021-01-01 01:41:44
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/917
Plant Science Today; Vol. 8 No. 1 (2021)
eng
Copyright (c) 2021 R S Thoyajakshi, D Poornima
oai:ojs.horizonepublishing.com:article/919
2021-04-01T08:44:37Z
PST:RCOM
driver
nmb a2200000Iu 4500
"210401 2021 eng "
2348-1900
dc
Growth and development of Lycium barbarum L. in the environment of Samarkand in Uzbekistan
Nurullayeva, Nodira
Department of Botany, Samarkand State University, Samarkand, 140163, Uzbekistan https://orcid.org/0000-0002-8266-979X
Haydarov, Khislat
Department of Botany, Samarkand State University, Samarkand, 140163, Uzbekistan https://orcid.org/0000-0003-0099-9822
Umurzakova, Zebiniso
Department of Botany, Samarkand State University, Samarkand, 140163, Uzbekistan http://orcid.org/0000-0003-0099-9822
Safarova, Dilfuza
Department of Botany, Samarkand State University, Samarkand, 140163, Uzbekistan http://orcid.org/0000-0002-5189-2489
Shrub Lycium barbarum belongs of the family Solanaceae, is introduced and does not occur naturally in Uzbekistan. Despite its numerous medicinal characteristics, in Uzbekistan, its growth and development have not been studied. Therefore, our primary goal was to study the germination of seeds, stages of ontogenesis and some morphological signs of fruits. The highest seed germination rate of 74±0,12% as at the 20 degree C. When studying ontogenesis, plant development was divided into ten stages and four periods. The pre-reproductive period lasted 1-2 years. The reproductive period was determined for 2-3 years from the beginning of the growing season. For several months, an analysis of the changes in the morphological characteristics of the fruits of L. barbarum was carried out and in May, relatively large ripened fruits were determined (length 2.18 ± 0.09, width 1.14 ± 0.11).
Horizon e-Publishing Group
2021-04-01 02:44:37
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/919
Plant Science Today; Vol. 8 No. 2 (2021)
eng
Copyright (c) 2021 Nodira Nurullayeva, Khislat Haydarov, Zebiniso Umurzakova, Dilfuza Safarova
oai:ojs.horizonepublishing.com:article/925
2020-10-01T06:47:29Z
PST:RCOM
driver
nmb a2200000Iu 4500
"201020 2020 eng "
2348-1900
dc
The assessment of winter wheat agrocenoses adaptivity in the conditions of the submontane zone of the Central Caucasus
Manukyan, I. R.
North Caucasus Research Institute of Mining and Predmont Agriculture, Vladikavkaz Scientific Center of the Russian Academy of Sciences, Vladikavkaz, Russia http://orcid.org/0000-0002-1620-4302
Miroshnikova, E.S.
North Caucasus Research Institute of Mining and Predmont Agriculture, Vladikavkaz Scientific Center of the Russian Academy of Sciences, Vladikavkaz, Russia http://orcid.org/0000-0003-0208-3631
Gasiev, V.I.
North Caucasus Research Institute of Mining and Predmont Agriculture, Vladikavkaz Scientific Center of the Russian Academy of Sciences, Vladikavkaz, Russia http://orcid.org/0000-0002-6133-4448
Abieva, T.S.
North Caucasus Research Institute of Mining and Predmont Agriculture, Vladikavkaz Scientific Center of the Russian Academy of Sciences, Vladikavkaz, Russia http://orcid.org/0000-0003-2647-5867
Machneva, N.L.
North Caucasus Research Institute of Mining and Predmont Agriculture, Vladikavkaz Scientific Center of the Russian Academy of Sciences, Vladikavkaz, Russia http://orcid.org/0000-0002-7580-5327
Skamarokhova, S.S.
North Caucasus Research Institute of Mining and Predmont Agriculture, Vladikavkaz Scientific Center of the Russian Academy of Sciences, Vladikavkaz, Russia
Yurin, D.A.
North Caucasus Research Institute of Mining and Predmont Agriculture, Vladikavkaz Scientific Center of the Russian Academy of Sciences, Vladikavkaz, Russia http://orcid.org/0000-0003-1517-4858
The article presents the results of 3 years study on the adaptation of the properties of various winter wheat varieties to the conditions of the submontane zone of the Central Caucasus. The indicator of the ontogenetic adaptability was the homeostaticity of the plants. We have studied thirty winter wheat varieties according to the parameters of ecological plasticity, productivity and resistance to the destructive complex of diseases and pests like Fusarium head blight, brown and yellow rust, Septoria blight, tan spot etc. The yield of the mixed variety crops was 4.5 t/ha; the increase was 9%. In the crops of the triple mixture of the strong Veda and Delta varieties (25%) with the valuable Batko variety (50%), which differed in resistance to various diseases, the average yield of 52 cwt/ha was obtained with the protein content of 12%, the gluten content of 28% and the flour strength of 320 a.u. The authors used the resistance of the precocious Kuma variety to the damage by the cereal leaf beetle as a protective screening crop along with the field perimeter. Such a screening crop of the stable variety prevents the colonization of the crops of the other less resistant varieties with pests. The genetic diversity of the variety creates the conditions for regulating and stabilizing the phytosanitary state of the crops and increasing their productivity. With this agrotechnical method, it becomes possible to regulate and stabilize the phytosanitary situation in the fields and to increase grain productivity and quality.
Horizon e-Publishing Group
2020-10-01 00:47:29
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/925
Plant Science Today; Vol. 7 No. 4 (2020)
eng
Copyright (c) 2020 I. R. Manukyan, E.S. Miroshnikova, V.I. Gasiev, T.S. Abieva, N.L. Machneva, S.S. Skamarokhova, D.A. Yurin
oai:ojs.horizonepublishing.com:article/932
2021-01-01T08:41:44Z
PST:RCOM
driver
nmb a2200000Iu 4500
"210101 2021 eng "
2348-1900
dc
Characterization of sodium alginate extracted from brown seaweeds growing on Veraval coast, Gujarat
Dangar, Kiran
Department of Life Sciences, Bhakta Kavi Narsinh Mehta University, Junagadh 362 001, Gujarat, India http://orcid.org/0000-0002-5459-8162
Varsani, Vaishali
Department of Life Sciences, Bhakta Kavi Narsinh Mehta University, Junagadh 362 001, Gujarat, India http://orcid.org/0000-0002-7288-0081
Vyas, suhas
Department of Life Sciences, Bhakta Kavi Narsinh Mehta University, Junagadh 362 001, Gujarat, India http://orcid.org/0000-0002-4458-3186
Marine environment is a major potential source of functional materials, including polysaccharides, vitamins, enzymes, oils, antioxidants and peptides. All these materials are extracted from different marine living organisms including microbes, plants and animals. Among these seaweeds or marine macroalgae are one of the important sources and they are a part of staple diet from time immemorial in the orient as they are nutritionally rich materials. Those species that adapted to these pressures will expand their living boundaries and higher potential of row material availability in industry like pharmaceutical market, textile, fertilizer and for animal and human consumption. The present study concerns about the specific brown seaweeds, which is suitable material for alginate and growing abundantly at seacoast of Gujarat. Out of many species of seaweeds growing on the coastline of Veraval, four species viz., Sargassum tenerrimum, Dictyota dichotoma, Spathoglossum asperum, Iyengaria stellata were selected for alginate extraction. The focus of this study is to utilize natural resources as alternatives and sustainability of human health to use sodium alginate as novel polymer and which is also biodegradable. It may be associated to other biologically active molecules and has a wide range of physicochemical and biochemical properties. Because of amazing properties, alginate and its salts are used in drug delivery system.
Horizon e-Publishing Group
2021-01-01 01:41:44
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/932
Plant Science Today; Vol. 8 No. 1 (2021)
eng
Copyright (c) 2021 Kiran Dangar, Vaishali Varsani, suhas Vyas
oai:ojs.horizonepublishing.com:article/960
2021-01-01T08:41:44Z
PST:RCOM
driver
nmb a2200000Iu 4500
"210105 2021 eng "
2348-1900
dc
Synergistic effect of calcium chloride and 1-Methylcyclopropene on storage of watermelon (Citrullus lanatus (Thunb.) Matsum. & Nakai)
Nguyen, Minh Phuoc
Faculty of Food Science and Technology, Thu Dau Mot University, Binh Duong Province, Vietnam https://orcid.org/0000-0001-5425-5277
Watermelon (Citrullus lanatus (Thunb.) Matsum. & Nakai) was a climacteric variety with a high respiration rate and ethylene accumulation. Therefore the fruit matures and softeness quickly during post-harvest period. Calcium chloride was popularly utilized as stabilizing agent. 1-methylcyclopropene (1-MCP) has been known to be highly effective inhibitor of ethylene reaction. This research evaluated the synergistic effect of CaCl2 and 1-methylcyclopropene (1-MCP) treatment to weight loss, firmness, total soluble solid, carotenoid, ascorbic acid and decay rate of watermelon during storage. Results showed that a combination of 2.5% CaCl2 and 0.6 ppm 1-MCP in 20 min of immersion could extend watermelon shelf life for 15 days. After 15 days of ambient storage, the weight loss (1.43±0.02 %), firmness (4.38±0.00 N), total soluble solid (13.60±0.01 oBrix), carotenoid (16.31±0.02 µg/100g), ascorbic acid (13.36±0.03 mg/100g), decay rate (0.47±0.02 %) were clearly presented. Meanwhile, the treatment of 2.5% CaCl2 alone showed the weight loss (2.11±0.02 %), firmness (3.03±0.02 N), total soluble solid (10.83±0.02 oBrix), carotenoid (12.97±0.03 µg/100g), ascorbic acid (9.57±0.02 mg/100g), decay rate (2.14±0.01 %). The incorporation of CaCl2 and 1-MCP created a synergistic effect on the improved quality of watermelon fruit during ambient storage.
Horizon e-Publishing Group
2021-01-01 01:41:44
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/960
Plant Science Today; Vol. 8 No. 1 (2021)
eng
Copyright (c) 2021 Minh Phuoc Nguyen Nguyen
oai:ojs.horizonepublishing.com:article/1007
2021-04-01T08:44:37Z
PST:RCOM
driver
nmb a2200000Iu 4500
"210401 2021 eng "
2348-1900
dc
Efficacy of fungicides, plant extracts and biocontrol agents against Ascochyta blight (Ascochyta rabiei) of chickpea (Cicer arietinum L.) under field conditions
Ahmad, Salman
College of Agriculture, University of Sargodha, Sargodha, Pakistan
Khan, Muhammad Aslam
Department of Plant Pathology, University of Agriculture, Faisalabad, Pakistan
Ahmad, Irfan
Department of Forestry and Range Management, University of Agriculture, Faisalabad, Pakistan
Iqbal, Zafar
College of Agriculture, University of Sargodha, Sargodha, Pakistan
Ashraf, Ejaz
College of Agriculture, University of Sargodha, Sargodha, Pakistan
Atiq, Muhammad
Department of Plant Pathology, University of Agriculture, Faisalabad, Pakistan
Ali, Yasir
College of Agriculture, Bahadur Sub-Campus Layyah, Bahauddin Zakariya University, Multan, Pakistan
Naseer, Saima
Plant Pathology Research Institute, Ayub Agriculture Research Institute, Faisalabad, Pakistan
Two fungicides, Aliette and ThiovitJet @ 0.15%, containing Aluminum tris (O-ethyl phosphonate) and sulphur compounds, respectively; two plant extracts, Melia azedarach and Azadirachta indica @ 8% and one biocontrol agent, Trichoderma harzianum @ 107 conidia ml-1 were investigated against ascochyta blight of chickpea under field conditions. Treatments were evaluated on three varieties susceptible to chickpea blight. Field trial revealed that Aliette and ThiovitJet significantly decreased disease severity to 17 and 23% respectively, followed by M. azedarach and A. indica which decreased severity to 50 and 56% respectively, compared to control with 75% disease severity. T. harzianum, with a severity of 63%, was significantly less effective than fungicides and both plant extracts in controlling blight disease. The current research revealed that systemic and sulphur containing fungicides, both plant extracts and the biocontrol agent have the potential to control ascochyta blight of chickpea.
Horizon e-Publishing Group
2021-04-01 02:44:37
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/1007
Plant Science Today; Vol. 8 No. 2 (2021)
eng
Copyright (c) 2021 Salman Ahmad, Muhammad Aslam Khan, Irfan Ahmad, Zafar Iqbal, Ejaz Ashraf, Muhammad Atiq, Yasir Ali, Saima Naseer
oai:ojs.horizonepublishing.com:article/1008
2021-01-27T16:15:10Z
PST:RCOM
driver
nmb a2200000Iu 4500
"210324 2021 eng "
2348-1900
dc
GC-MS analysis and in silico activity prediction of phytocompounds in the roots of Chrysopogon zizanioides (L.) Roberty
Shanti, V C N
Department of Botany, Sacred Heart College, Thevara 682 013, Kochi, Kerala, India https://orcid.org/0000-0001-9409-1051
Neerakkal, I
Department of Botany, Sacred Heart College, Thevara 682 013, Kochi, Kerala, India https://orcid.org/0000-0002-1244-4712
Chrysopogon zizanioides (L.) Roberty (Poaceae) commonly known as Ramachamis an aromatic, vigorous growing perennial grass with medicinal properties. The plant is tolerant to extreme soil and climatic conditions and is known for its cooling properties. Roots of the plant are widely used as body scrubber and is suggested for skin diseases in Ayurveda. The present work aims to identify the components in the crude methanolic root extract of C. zizanioides using GC-MS and also to predict the pharmacokinetic behaviour of selected compounds in silico using Swiss ADME online server . 41 compounds were identified of which sesquiterpenes formed the major group. Sesquiterpene Vetivenic acid was the compound with a maximum peak area of 38.9%. Components identified is reported to possess a range of biological activities like anti oxidant, antibacterial, anti cancer, anti inflammatory, anti ulcer, analgesic and insecticidal activities. Compounds with higher peak area like Vetivenic acid, beta vatirenene, beta.-Cedren-9-.alpha.-ol, D Viridiflorol, Gamma muurolene, (Z,E)-alpha-farnesene, Nootkatone, Aromadendrene oxide-(2), 7-Acetyl-2-hydroxy-2methyl-5isopropylbicyclo[4.3.0] nonane, Rosifoliol, 9,10-dehydro isolongifolene, Ylangenol, 4,7,10,13,16,19-Docosahexaenoic acid methyl ester, Carbonic acid, propargyl 2,2,2-tri chloroethyl ester, Oxacyclotetradeca-4,11-diyne, beta eudesmol and longifolene were evaluated in silico. All these compounds proved to obey Lipinski's rule-of-five and were water soluble. Vetivenic acid showed a good bioavailability score of 85% while the others showed 55%. None of the compounds were substrates to P glycoprotein. The values predicted may be used for preliminary evaluation of pharmacological properties of C. zizanioides and also as monographs for the development of potential semisynthetic or synthetic drugs.
Horizon e-Publishing Group
2021-01-01 01:41:44
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/1008
Plant Science Today; Vol. 8 No. 1 (2021)
eng
Copyright (c) 2021 V C N Shanti, I Neerakkal
oai:ojs.horizonepublishing.com:article/1014
2021-01-11T14:47:05Z
PST:RCOM
driver
nmb a2200000Iu 4500
"210207 2021 eng "
2348-1900
dc
Habenaria diphylla (Nimmo) Dalzell (Orchidaceae), new record for the flora of Vietnam
Van, Hong Thien
Institute of Biotechnology and Food Technology, Industrial University of Ho Chi Minh City, No. 12 Nguyen Van Bao Street, Ward 4, Go Vap District, Ho Chi Minh City, Vietnam http://orcid.org/0000-0003-0151-5068
Nguyen, Thi Hong Van
Institute of Biotechnology and Food Technology, Industrial University of Ho Chi Minh City, No. 12 Nguyen Van Bao Street, Ward 4, Go Vap District, Ho Chi Minh City, Vietnam http://orcid.org/0000-0003-0264-7564
Le, Hong Thia
Institute of Environmental Science, Engineering and Management, Industrial University of Ho Chi Minh City, No. 12 Nguyen Van Bao Street, Go Vap District, Ho Chi Minh City, Vietnam
Trinh, Ngoc Nam
Office of Science Management and International Affairs, Industrial University of Ho Chi Minh City, No. 12 Nguyen Van Bao Street, Go Vap District, Ho Chi Minh City, Vietnam http://orcid.org/0000-0002-7983-7270
Huynh, Nguyen Tuong An
Office of Postgraduate Management, Industrial University of Ho Chi Minh City, No. 12 Nguyen Van Bao Street, Go Vap District, Ho Chi Minh City, Vietnam
Le, Van Son
Binh Chau-Phuoc Buu Nature Reserve, Bung Rieng Ward, Xuyen Moc District, Ba Ria-Vung Tau Province, Vietnam http://orcid.org/0000-0003-0151-0646
Phan, Thi Thanh Nha
Department of Ecology and Evolutionary Biology, University of Science, Vietnam National University HCMC, 227 Nguyen Van Cu Street, District 5, Ho Chi Minh City, Vietnam http://orcid.org/0000-0002-1759-586X
Dang, Le Anh Tuan
Department of Ecology and Evolutionary Biology, University of Science, Vietnam National University HCMC, 227 Nguyen Van Cu Street, District 5, Ho Chi Minh City, Vietnam http://orcid.org/0000-0002-9794-0669
Habenaria diphylla (Nimmo) Dalzell is reported for the first time as a new discovery for the flora of Vietnam based on the specimens collected in Binh Chau-Phuoc Buu Nature Reserve, Ba Ria-Vung Tau Province. The present study provided the detailed characteristics of the species including detailed photographs of the morphological characteristics, the cross section of the leaf, inflorescence axis and root. Furthermore, the information about the species, including distribution, habitat, ecology and conservation status were also provided.
Horizon e-Publishing Group
2021-01-01 01:41:44
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/1014
Plant Science Today; Vol. 8 No. 1 (2021)
eng
Copyright (c) 2021 Thien Hong Van, Thi Hong Vang Nguyen, Hong Thia Le; Ngoc Nam Trinh; Nguyen Tuong An Huynh, Van Son Le, Thi Thanh Nha Phan, Le Anh Tuan Dang
oai:ojs.horizonepublishing.com:article/1046
2021-01-02T13:31:55Z
PST:RCOM
driver
nmb a2200000Iu 4500
"210207 2021 eng "
2348-1900
dc
A new distributional record of bladderwort species Utricularia janarthanamii for Gujarat state
Gadhvi, Kamlesh
Department of Life Sciences, Bhakta Kavi Narsinh Mehta University, Junagadh, Gujarat, India https://orcid.org/0000-0002-4157-2780
Gamit, Sandip
Department of Life Sciences, Bhakta Kavi Narsinh Mehta University, Junagadh, Gujarat, India https://orcid.org/0000-0002-2953-6728
Dudhagara, Dushyant
Department of Life Sciences, Bhakta Kavi Narsinh Mehta University, Junagadh, Gujarat, India https://orcid.org/0000-0002-6561-1641
Vyas, Suhas
Department of Life Sciences, Bhakta Kavi Narsinh Mehta University, Junagadh, Gujarat, India https://orcid.org/0000-0002-4458-3186
Yadav, Rashmi
St. Xavier’s College (Autonomous), Ahmedabad, Gujarat, India https://orcid.org/0000-0002-2702-3777
We report the first distributional record of Utricularia janarthanamii S.R. Yadav, Sardesai & S.P. Gaikwad from Girnar of Saurashtra region, Gujarat state. Saurashtra region comprises a wide variety of biological diversity as it consists of sandy, coastal and rocky habitats. The morphology and ecology of this species are described in this paper. This study adds new information on the flora of Gujarat and extended the distribution of this species in the Girnar mountain region.
Horizon e-Publishing Group
2021-01-01 01:41:44
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/1046
Plant Science Today; Vol. 8 No. 1 (2021)
eng
Copyright (c) 2021 Kamlesh Gadhvi, Sandip Gamit, Dushyant Dudhagara, Suhas Vyas, Rashmi Yadav
oai:ojs.horizonepublishing.com:article/1069
2021-08-19T05:19:12Z
PST:RCOM
driver
nmb a2200000Iu 4500
"210701 2021 eng "
2348-1900
dc
Development and acceptability of mead wine with calamansi fruit flavor
Baua, Mary Ann I
Isabela State University, San Mariano, Isabela 3332, Philippines https://orcid.org/0000-0002-7050-973X
The study discusses the development and acceptability of Mead wine with Calamansi fruit flavor. Mead can have a wide range of flavors depending on the source of the honey, added substances counting natural product and flavors, the yeast utilized amid maturation and the maturing method. In this study, the researcher used calamansi fruit as its flavour since there is a rich cultivation and plantation of calamansi fruit in the locale of the study. Thirty individuals assessed the mead wine with calamansi fruit flavour in terms of appearance, aroma, flavour and texture. The research has used various statistical treatments such as Mean and T-test in evaluating the obtained data. It was found out that the mean wine with calamansi fruit flavor had an alcohol content of 12%. Furthermore, the respondents extremely like the mead wine with calamansi flavour because of its appearance and aroma which obtained the highest appraisal of the respondents based on their sensory evaluation. The study uncovered that calamansi fruit flavour has the potential to be utilized as an ingredient for mead wine production. Moreover, amid the appraisal of the respondents, the aroma, flavour, appearance and texture of the produced mead wine with calamansi fruit flavour was essentially influenced. Generally, the taster respondents have extremely liked the mead wine with calamansi fruit flavour. Therefore, it is a highly appropriate commodity in the community and can be a potential income source and generating enterprise.
Horizon e-Publishing Group
2021-07-01 03:34:22
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/1069
Plant Science Today; Vol. 8 No. 3 (2021)
eng
Copyright (c) 2021 Mary Ann I Baua
oai:ojs.horizonepublishing.com:article/1071
2021-12-04T12:28:03Z
PST:RCOM
driver
nmb a2200000Iu 4500
"211001 2021 eng "
2348-1900
dc
Anthelmintic efficacy of tuba (Croton tiglium L.) seeds on the gastrointestinal parasites of native chickens (Gallus domesticus)
Abon, April Corazon
College of Agriculture, Forestry and Engineering, Quirino State University, 3401, Philippines https://orcid.org/0000-0002-1291-6767
The efficacy of capsulized Croton tiglium L. (CCT) seeds on the gastrointestinal parasites of native chickens (Gallus domesticus) was tested in experiments. A total of thirty-six free-range native chickens naturally infected with gastrointestinal parasites were divided into four treatment groups (positive control of levamisole+niclosamide, 200 mg, 300 mg and 400 mg CCT seeds) following a completely randomized design (CRD). Prior to treatment and on the 3rd, 6th, 9th and 12th days after treatment, the fecal egg count per gram was measured using the mc master technique. The analysis of variance (ANOVA) was used to statistically analyze all the data obtained. Using Least Significant Differences (LSD), significant differences between treatments were compared. On the day twelve after treatment, percent efficacy of capsulized Croton tiglium seeds on Ascaridia galli/Heterakis gallinarum at 200 mg and 400 mg was highly effective. The comparative cost analysis of the four treatments showed that the use of C. tiglium seeds resulted in a lower cost compared to the commercial dewormer. Commercial anthelmintic was more costly compared to the cost of capsulized C. tiglium seeds on T4 (400mg CCT) by 89. 67 %. The findings indicate the ability of Croton tiglium seeds in native chickens (Gallus domesticus) particularly against Ascaridia galli/Heterakis gallinarum as an alternative anthelmintic.
Horizon e-Publishing Group
2021-10-01 07:27:50
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/1071
Plant Science Today; Vol. 8 No. 4 (2021)
eng
Copyright (c) 2021 April Corazon Abon
oai:ojs.horizonepublishing.com:article/1133
2021-08-19T05:19:12Z
PST:RCOM
driver
nmb a2200000Iu 4500
"210701 2021 eng "
2348-1900
dc
Phylogenetic study of mangrove associate grass Myriostachya wightiana (Nees ex Steud.) Hook. f. using rbcL gene sequence
Kiran, K M
Department of Biotechnology, College of Science and Technology, Andhra University, Visakhapatnam, Andhra Pradesh, India https://orcid.org/0000-0002-5168-1876
Sandeep, B V
Department of Biotechnology, College of Science and Technology, Andhra University, Visakhapatnam, Andhra Pradesh, India https://orcid.org/0000-0003-3409-4802
Myriostachya is a monotypic genus in the family Poaceae, with the only known species Myriostachya wightiana (Nees ex Steud.) Hook.f. It is a mangrove associate grass primarily distributed along the muddy streams and channels in intertidal mangrove swamps of India, Bangladesh, Sri Lanka, Myanmar, Thailand and Sumatra. Molecular identification and evolutionary studies of M. wightiana is unreported till now. Therefore, in this study, the phylogenetic analysis of M. wightiana was established with related family members by using chloroplast rbcL gene-based systematics. The molecular phylogeny was accomplished by DNA extraction, PCR amplification and sequencing of the rbcL gene and phylogenetic analysis. The genomic DNA was extract using the CTAB method and the rbcL gene amplification is by using the F-5IATGTCACCACAAACAGAAACTAAAGC3I and R-5ICTTCGGCACAAAATAAGAAACGATCTC3I primers. Phylogenetic analysis of M. wightiana was performed by multiple sequence alignment with UPGMA, and the Maximum-parsimony phylogenetic tree was constructed using MEGAX. Myriostachya wightiana rbcL gene sequence shows the highest similarity to Paspalum species, and in the phylogenetic tree M. wightiana has a close branch with Paspalum vaginatum. The evolutionary divergence from M. wightiana is maximum (0.49) to Sorghum propinquum and minimum (0.01) to Oryza officinalis and Oryza punctata. This study concluded that M. wightiana has a strong morphological and phylogenetic relationship with salt-tolerant Paspalum sp.
Horizon e-Publishing Group
2021-07-01 03:34:22
Peer-reviewed Article
application/pdf
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/1133
Plant Science Today; Vol. 8 No. 3 (2021)
eng
Copyright (c) 2021 K M Kiran, B V Sandeep
oai:ojs.horizonepublishing.com:article/1137
2021-08-19T05:19:12Z
PST:RCOM
driver
nmb a2200000Iu 4500
"210701 2021 eng "
2348-1900
dc
Powder microscopic, physicochemical and chromatographic approach for the quality control of anti-hypertensive drug Rattha Piththathirku Kudinir Chooranam
Mandal, Achintya Kumar
Department of Chemistry, Siddha Central Research Institute (Central Council for Research in Siddha, Ministry of AYUSH, Government of India), Anna Hospital Campus, Arumbakkam, Chennai 600 106, Tamil Nadu, India https://orcid.org/0000-0003-4967-2310 https://orcid.org/0000-0003-4967-2310
Sujith, Thatipelli
Department of Chemistry, Siddha Central Research Institute (Central Council for Research in Siddha, Ministry of AYUSH, Government of India), Anna Hospital Campus, Arumbakkam, Chennai 600 106, Tamil Nadu, India https://orcid.org/0000-0002-1697-434X
Rajesh, Allu
Department of Chemistry, Siddha Central Research Institute (Central Council for Research in Siddha, Ministry of AYUSH, Government of India), Anna Hospital Campus, Arumbakkam, Chennai 600 106, Tamil Nadu, India https://orcid.org/0000-0002-0012-6098
Divya , Kallingil Gopi
Department of Pharmacognosy, Siddha Central Research Institute (Central Council for Research in Siddha, Ministry of AYUSH, Government of India), Anna Hospital Campus, Arumbakkam, Chennai 600 106, Tamil Nadu, India https://orcid.org/0000-0002-9296-2308
Sunilkumar, Koppala Narayana
Department of Pharmacognosy, Siddha Central Research Institute (Central Council for Research in Siddha, Ministry of AYUSH, Government of India), Anna Hospital Campus, Arumbakkam, Chennai 600 106, Tamil Nadu, India https://orcid.org/0000-0003-4286-3069
Shakila, Ramachandran
Department of Chemistry, Siddha Central Research Institute (Central Council for Research in Siddha, Ministry of AYUSH, Government of India), Anna Hospital Campus, Arumbakkam, Chennai 600 106, Tamil Nadu, India https://orcid.org/0000-0002-4123-9224
The present work aims to study powder microscopy, physicochemical and high-performance thin-layer chromatography photo documentation and fingerprint profiles of a Siddha drug, Rattha Piththathirku Kudinir Chooranam (RPK). The raw drugs were collected, authenticated and the RPK was prepared. Then the drug was investigated for powder microscopic characters, physicochemical parameters, Thin Layer Chromatographic photo documentation (TLC), High-Performance Thin-Layer Chromatographic (HPTLC) fingerprint profiles of successive n-hexane, successive chloroform, successive ethanol and hydro alcohol (1:1) extracts. The successive and hydro alcohol extracts of the drug displayed distinct TLC spots and HPTLC peaks which are distinct to this drug.
Horizon e-Publishing Group
2021-07-01 03:34:22
Peer-reviewed Article
application/pdf
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/1137
Plant Science Today; Vol. 8 No. 3 (2021)
eng
Copyright (c) 2021 Achintya Kumar Mandal, Thatipelli Sujith, Allu Rajesh, Kallingil Gopi Divya , Koppala Narayana Sunilkumar, Ramachandran Shakila
oai:ojs.horizonepublishing.com:article/1141
2021-08-19T05:19:12Z
PST:RCOM
driver
nmb a2200000Iu 4500
"210701 2021 eng "
2348-1900
dc
Identification and characterization of phytoconstituents of ethanolic root extract of Clitoria ternatea L. utilizing HR-LCMS analysis
Jiji, K N
Department of Pharmacology, C.L.Baid Metha College of Pharmacy, (Affiliated to Tamil-Nadu Dr.M.G.R Medical University), Chennai 600 097, India https://orcid.org/0000-0002-7009-3260
Muralidharan, P
Department of Pharmacology, C.L.Baid Metha College of Pharmacy, (Affiliated to Tamil-Nadu Dr.M.G.R Medical University), Chennai 600 097, India https://orcid.org/0000-0003-0495-236X
Medicinal plants act as a vital source in improving health and overcoming the side effects of modern-day medicine. Many evidence-based reports are present in the literature about the benefits of medicinal plants. Clitoria ternatea L. belongs to the family Fabaceae and is known to be one of the important Ayurvedic medicinal plant whose uses are specified mainly for the modification of nervous system activities. ‘Medhyarasayana’ is one of the Ayurvedic formulations which is used to promote the intellectual capacity, revive the body and nervous tissue, Clitoria ternatea serves as a major constituent of ‘Medhyarasayana.’ Identification and characterization of active metabolites of C. ternatea will help to isolate the important phytoconstituents responsible for the central nervous system effects, isolated components can be utilized in future for the formulation of new medicine for various neurodegenerative disorders. In the present study, the phytochemical evaluation of the ethanolic root extract of C. ternatea (EECT) was performed using the HR-LCMS technique. Preliminary qualitative phytoconstituents analysis showed the presence of tannins, alkaloids, saponins, steroids, carbohydrate, protein, flavonoids and triterpenoids in the ethanolic root extract. Almost 42 compounds were identified when the EECT subjected to HR-LCMS analysis.
Horizon e-Publishing Group
2021-07-01 03:34:22
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/1141
Plant Science Today; Vol. 8 No. 3 (2021)
eng
Copyright (c) 2021 K N Jiji, P Muralidharan
oai:ojs.horizonepublishing.com:article/1153
2021-08-19T05:19:12Z
PST:RCOM
driver
nmb a2200000Iu 4500
"210701 2021 eng "
2348-1900
dc
Notes on the typification of three names in the genus Arundinella Raddi (Poaceae)
Jaiswal, Shubham
Plant Diversity, Systematics and Herbarium Division, CSIR- National Botanical Research Institute, Rana Pratap Marg, Lucknow, India 226 001 & Department of Botany, D.D.U. Gorakhpur University, Gorakhpur, India 273 009 https://orcid.org/0000-0003-4308-880X
Tripathi, Shailja
Plant Diversity, Systematics and Herbarium Division, CSIR- National Botanical Research Institute, Rana Pratap Marg, Lucknow, India 226 001 https://orcid.org/0000-0003-0089-4203
Prasad, Dileshwar
Plant Diversity, Systematics and Herbarium Division, CSIR- National Botanical Research Institute, Rana Pratap Marg, Lucknow, India 226 001 https://orcid.org/0000-0002-1835-4320
Yadav, Rekha
Plant Diversity, Systematics and Herbarium Division, CSIR- National Botanical Research Institute, Rana Pratap Marg, Lucknow, India 226 001 & Department of Botany, D.D.U. Gorakhpur University, Gorakhpur, India 273 009 https://orcid.org/0000-0002-5181-7104
Madhukar, Virendra K
Department of Botany, D.D.U. Gorakhpur University, Gorakhpur, India 273 009 https://orcid.org/0000-0001-9445-860X
Agnihotri, Priyanka
Department of Botany, D.D.U. Gorakhpur University, Gorakhpur, India 273 009 https://orcid.org/0000-0001-5957-9991
In the present study, lectotypes for three names in the genus Arundinella Raddi are designated. Lectotypification of A. intricata and second-step lectotypification of A. laxiflora and A. mesophylla has been done. Additionally, the geographic distribution of endemic species, A. mesophylla is also provided.
Horizon e-Publishing Group
2021-07-01 03:34:22
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/1153
Plant Science Today; Vol. 8 No. 3 (2021)
eng
Copyright (c) 2021 Shubham Jaiswal, Shailja Tripathi, Dileshwar Prasad, Rekha Yadav, Virendra K Madhukar, Priyanka Agnihotri
oai:ojs.horizonepublishing.com:article/1174
2021-12-04T12:28:03Z
PST:RCOM
driver
nmb a2200000Iu 4500
"211001 2021 eng "
2348-1900
dc
Morphological study of Nyctanthes arbor-tristis L. fruit and seed in different growth stages
Modak, Keya
Taxonomy of Angiosperms & Biosystematics Lab., Department of Botany, University of North Bengal, Raja Rammohunpur, Darjeeling, West Bengal 734 013, India https://orcid.org/0000-0001-9870-816X
Chowdhury, Monoranjan
Taxonomy of Angiosperms & Biosystematics Lab., Department of Botany, University of North Bengal, Raja Rammohunpur, Darjeeling, West Bengal 734 013, India https://orcid.org/0000-0002-7978-1713
Qualitative and quantitative morphological characterization in different growth stages of Nyctanthes arbor-tristis L. fruits and seeds were investigated. Capsules are compressed, two celled, green, cordate to round or elliptical with one flattened seed in each half. Both LM and SEM study were conducted to gather micromorphological features of matured epicarp and seed testa. Non-glandular, uniseriate, slender trichome and anomocytic stomata were found on epicarp, whereas same was absent on seeds. Some crystalline substance was noticed on both epicarp cells and seed testa. The fruiting stages were divided into 0 to V stages starting from first day of fruit appearing and total required days needed for maturity. Remarkable differences such as fruit and seed size, weight and colour were varied in each stage. Significance of surface micromorphology of matured epicarp and seed testa of N. arbor-tristis is also discussed here. Single-factor ANOVA analysis and Regression were performed to test the significance level of the studied parameters and their relationship.
Horizon e-Publishing Group
2021-10-01 07:27:50
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/1174
Plant Science Today; Vol. 8 No. 4 (2021)
eng
Copyright (c) 2021 Keya Modak, Monoranjan Chowdhury
oai:ojs.horizonepublishing.com:article/1192
2021-08-19T05:19:12Z
PST:RCOM
driver
nmb a2200000Iu 4500
"210701 2021 eng "
2348-1900
dc
Evaluation of surface coating and shrink- wrap packaging on shelf life and quality of mango cultivar ‘Neelum’
Gomez, Saji
Assistant Professor, Department of Post Harvest Technology, College of Agriculture, Kerala Agricultural University, Vellanikkara, Thrissur 680 656, Kerala, India https://orcid.org/0000-0003-1059-2460
Jacob, Sharon
Research Associate, Department of Post Harvest Technology, College of Agriculture, Kerala Agricultural University, Vellanikkara, Thrissur 680 656, Kerala, India https://orcid.org/0000-0003-4890-1695
Joseph, Meagle
Associate Professor, Department of Post Harvest Technology, College of Agriculture, Kerala Agricultural University, Vellanikkara, Thrissur 680 656, Kerala, India https://orcid.org/0000-0002-1546-636X
Johnson , Dhanya
Research Associate, Department of Post Harvest Technology, College of Agriculture, Kerala Agricultural University, Vellanikkara, Thrissur 680 656, Kerala, India https://orcid.org/0000-0003-4779-5018
Sebastian, Karishma
Research Associate, Department of Post Harvest Technology, College of Agriculture, Kerala Agricultural University, Vellanikkara, Thrissur 680 656, Kerala, India https://orcid.org/0000-0002-1291-5860
Kerala, the Indian state has the distinction of producing the earliest mangoes in the country, in February and the season extends up to May, coinciding with South West monsoon. Mango cultivar ‘Neelum’, the last commercial variety to attain maturity in the State is hampered by the incidence of fruit fly and anthracnose disease. An attempt was made during 2019-20 to extend the availability of the fruits of this cultivar by giving a surface coating with ‘Nipro Fresh’ wax containing the fungicide, Carbendazim, followed by shrink-wrap packaging in trays made of areca nut leaf sheath, before sanitizing with chlorine (100 ppm) and alum solution (1%). Surface coating with ‘Nipro Fresh’, followed by shrink-wrap packaging of trays containing mangoes, and their subsequent storage in cool chamber at 12-13 °C and 85-90 % relative humidity, extended the shelf life by 54 days, compared to the uncoated and unwrapped samples which had a shelf life of 9 days under ambient conditions. Respiration rate, physiological loss in weight, total soluble solids and carotenoids showed a steady rise while titratable acidity, total phenols and ascorbic acid recorded a declining trend.
Horizon e-Publishing Group
2021-07-01 03:34:22
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/1192
Plant Science Today; Vol. 8 No. 3 (2021)
eng
Copyright (c) 2021 Saji Gomez, Sharon Jacob, Meagle Joseph, Dhanya Johnson , Karishma Sebastian
oai:ojs.horizonepublishing.com:article/1209
2021-08-19T05:19:12Z
PST:RCOM
driver
nmb a2200000Iu 4500
"210701 2021 eng "
2348-1900
dc
Sterculia striatiflora Mast (Malvaceae s.l.) - A new addition to the flora of Assam
Baruah, Manash
Department of Botany, Gauhati University, Gopinath Bordoloi Nagar, Guwahati 781 014, Assam, India https://orcid.org/0000-0003-3064-2605
Dey, Debolina
Department of Botany, Gauhati University, Gopinath Bordoloi Nagar, Guwahati 781 014, Assam, India https://orcid.org/0000-0002-0048-8363
Boruah, Saurav Kumar
Department of Botany, Gauhati University, Gopinath Bordoloi Nagar, Guwahati 781 014, Assam, India https://orcid.org/0000-0001-8286-5603
Paul, Monish
Department of Botany, Gauhati University, Gopinath Bordoloi Nagar, Guwahati 781 014, Assam, India https://orcid.org/0000-0002-6556-2712
Bhuyan, Birina
Department of Botany, Bodoland University, Kokrajhar 783 370, Assam, India https://orcid.org/0000-0002-6421-8477
Devi, Nilakshee
Department of Botany, Gauhati University, Gopinath Bordoloi Nagar, Guwahati 781 014, Assam, India https://orcid.org/0000-0002-6007-4904
Sterculia striatiflora Mast, a rarely known species of Malvaceae s.l., is reported here as a new distribution record and addition to the Flora of Assam, India. A detailed description, colour photographs and other relevant information has been provided for its identification.
Horizon e-Publishing Group
2021-07-01 03:34:22
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/1209
Plant Science Today; Vol. 8 No. 3 (2021)
eng
Copyright (c) 2021 Manash Baruah, Debolina Dey, Saurav Kumar Boruah, Monish Paul, Birina Bhuyan, Nilakshee Devi
oai:ojs.horizonepublishing.com:article/1221
2021-08-19T05:19:12Z
PST:RCOM
driver
nmb a2200000Iu 4500
"210731 2021 eng "
2348-1900
dc
Iphigenia magnifica Ansari & R.S. Rao (Colchicaceae) – A new distributional record to the flora of Eastern Ghats, India
Vallepu, Nagaraju
Department of Botany, Sri Venkateswara University, Tirupati 517 502, Andhra Pradesh, India https://orcid.org/0000-0002-8800-8829
Mitta, Mahendra Nath
Department of Botany, Sri Venkateswara University, Tirupati 517 502, Andhra Pradesh, India https://orcid.org/0000-0002-5907-7796
Arisdason, W
Botanical Survey of India, Southern Regional Centre, TNAU Campus, Lawley Road, Coimbatore 641 003, Tamil Nadu, India https://orcid.org/0000-0002-9582-2036
Iphigenia magnifica Ansari & R.S. Rao (Liliales: Colchicaceae), an endemic species of Western Ghats is reported in this communication as a new distributional record for Eastern Ghats from Seshachalam hills of Eastern Ghats, Andhra Pradesh. The present communication provides description of this species along with photographs of habitat, live plant and herbarium specimen, comparison with its allied species, ecology and conservation assessment.
Horizon e-Publishing Group
2021-07-01 03:34:22
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/1221
Plant Science Today; Vol. 8 No. 3 (2021)
eng
Copyright (c) 2021 Nagaraju Vallepu; Mahendra Nath Mitta; W Arisdason
oai:ojs.horizonepublishing.com:article/1251
2021-12-04T12:28:03Z
PST:RCOM
driver
nmb a2200000Iu 4500
"220205 2022 eng "
2348-1900
dc
Adoption of potato varieties in West and Kellem Wollega Zones, Ethiopia
Alemu, Itefa Degefa
Department of Biology, Dambi Dollo University, Post: 260, Dambi Dollo, Ethiopia https://orcid.org/0000-0002-1269-3241
Melkamu Tamiru Addisu
Department of Biology, Dambi Dollo University, Post: 260, Dambi Dollo, Ethiopia https://orcid.org/0000-0003-1102-3876
Potato (Solanum tuberosum L.) is one of the possible food security crops which provide high yield and quality product in short period of time. Due to the lack of clearly known best varieties of it, its adoption to farmers is very less. The present study was conducted to assess the type of potato farmers prefer, adoption of released potato varieties and its management practices in west and Kellem Wollega Zones, Ethiopia. Survey was carried out in Ayira, Yubdo, Hawa Gelan, Dale Wabara and Dale Sadi woreda where four kebeles were purposively selected based on the potato farming potential. Open and close ended interview questions were generated for 384 selected representative farmers. Data was analyzed by SPSS software. The result showed that, 97.6% of the farmers have willing to farm potato. 47.3% and 22.7% of them experienced to farm local potato (land race) and released potato varieties, respectively. Farmers use landrace potato due to less awareness to released potato and accessibility of local potato. 70.1% of farmers responded there is no adoption of released potato in the area. Factors hindering potato farming in the study area are potato disease and lack of released potato. The least method used by farmers is use of resistant potato. Generally, there is scarcity of released potato seeds indicating that there is no its adoption in the study site. This problem is enforcing farmers to use local potato varieties which may not resist above stated hindering factors and make farmers to face food insecurity problems and economic reduction. Therefore, improving locally existing potato or attracting the improved potato varieties from elsewhere to the zones may be a solution of its adoption.
Horizon e-Publishing Group
2021-10-01 07:27:50
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/1251
Plant Science Today; Vol. 8 No. 4 (2021)
eng
Copyright (c) 2021 Itefa Degefa Alemu, Melkamu Tamiru Addisu
oai:ojs.horizonepublishing.com:article/1252
2021-08-19T05:19:12Z
PST:RCOM
driver
nmb a2200000Iu 4500
"210701 2021 eng "
2348-1900
dc
Evaluating yield and related trait of Haricot Bean varieties at Dambi Dollo University Research Site, Ethiopia
Alemu, Itefa Degefa
Department of Biotechnology, College of Natural and Computational Science, Dambi Dollo University, 260 Dambi Dollo, Ethiopia https://orcid.org/0000-0002-1269-3241
Abriham, Abdisa
Department of Natural Resource Management, College of Agriculture and Veterinary Medicine, Dambi Dollo University, 260 Dambi Dollo, Ethiopia https://orcid.org/0000-0001-9521-7461
Shuma, Soresa
Department of Animal Science, College of Agriculture and Veterinary Medicine, Dambi Dollo University, 260 Dambi Dollo, Ethiopia https://orcid.org/0000-0001-9326-8142
Haricot bean (Phaseolus vulagris L.) is an annual crop cultivated for food as it has high protein content. The objective of this study was to evaluate yield and yield-related traits of haricot bean varieties at the Dollo University research site. Five released and four local haricot bean varieties were used on 3 × 2 m (6 m2) experimental plots using randomized complete block design with three replications. Data pertaining to agronomic traits and yield performance of each variety were recorded and analyzed using R software version 4.0.5 and Microsoft Excel 2010. One way multivariate analysis showed a significant difference (p <0.05) in thousand seed weight. SAB-632, Local-4 (‘Burree’) and SAB-736 showed higher yield than the other haricot bean varieties. They are also high in all agronomic traits except SAB-736. Thousand seed weight and yield were high and significant with positively correlated to each other. Plant height had a high and significant positive correlation with the number of branches and seeds per plant. Generally, it is possible to say that haricot bean varieties, SAB-632 and Local-4(‘Burree’) are preferable in yield at the Dambi Dollo University research site according to the present findings. Therefore, it is good if these two haricot bean varieties are practised for multiplication at Dambi Dollo Research site and other related agro ecologies.
Horizon e-Publishing Group
2021-07-01 03:34:22
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/1252
Plant Science Today; Vol. 8 No. 3 (2021)
eng
Copyright (c) 2021 Itefa Degefa Alemu, Abdisa Abriham, Soresa Shuma
oai:ojs.horizonepublishing.com:article/1263
2022-05-09T12:28:32Z
PST:RCOM
driver
nmb a2200000Iu 4500
"220401 2022 eng "
2348-1900
dc
Phytochemical analysis and antioxidant activities of Artemisia stelleriana Besser leaf extracts
Mayuri , M
Department of Life sciences, CHRIST (Deemed to be University), Karnataka, India https://orcid.org/0000-0002-5157-6646
Asima , D
Department of Life sciences, CHRIST (Deemed to be University), Karnataka, India https://orcid.org/0000-0002-4893-2208
Joseph , K S
Department of Life sciences, CHRIST (Deemed to be University), Karnataka, India https://orcid.org/0000-0003-4384-2462
The present study aims to report the proximate and mineral composition, phenolic contents, and antioxidant potential of Artemisia stelleriana leaves. The leaf extracts were prepared using various solvents like distilled water, methanol, ethanol, and acetone and analyzed for their phenolic and flavonoid contents and antioxidant activity. The methanolic extracts showed the highest total phenolic and flavonoid contents (10.09 ± 0.24 mg GAE/g and 225.04 ± 0.38 mg QE/ g, respectively). The methanolic extracts showed significantly higher 1,1-Diphenyl-2-picrylhydrazyl radical scavenging assay (DPPH-RSA), Reducing power assay, and total antioxidant capacity compared to distilled water, ethanol, and acetone extracts. Gas Chromatography-Mass Spectroscopy revealed that the methanolic extracts of leaves to be a good source of bioactive compounds like 2,4-di-tert-butylphenol (2,4-DTBP), neophytadiene, octacosane, and eucalyptol.
Horizon e-Publishing Group
2022-04-01 09:04:32
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/1263
Plant Science Today; Vol. 9 No. 2 (2022)
eng
Copyright (c) 2021 M Mayuri , D Asima , K S Joseph
oai:ojs.horizonepublishing.com:article/1278
2021-12-04T12:28:03Z
PST:RCOM
driver
nmb a2200000Iu 4500
"220205 2022 eng "
2348-1900
dc
Trees of Yadahalli Chinkara Wildlife Sanctuary, Bagalkot, Karnataka, India: A checklist
Koti, Maheshwari
Taxonomy and Floristic Laboratory, Department of Botany, Karnatak University’s, Karnataka Science College, Dharwad, India https://orcid.org/0000-0002-1436-0483
Kotresha, K
Taxonomy and Floristic Laboratory, Department of Botany, Karnatak University’s, Karnataka Science College, Dharwad, India https://orcid.org/0000-0003-1035-3937
Yadahalli Chinkara Wildlife Sanctuary is located in semi-arid zone of north Karnataka with heterogeneous vegetation types within it. The forest has variable geographical features such as rocky slopes, open grass lands, scrub forest, seasonal minor waterfalls and lakes. The present paper provides a checklist of tree species of Yadahalli Chinkara Wildlife Sanctuary, Bagalkot, which spreads over the Bilagi and Mudhol taluka. The list comprises of 80 tree species belonging to 67 genera of 34 families. The family Fabaceae contributes 23 species followed by Moraceae, Rubiaceae and Rutaceae 4 species each. Out of 80 species, three species are endemic to Peninsular India, four species are Vulnerable (VU), and one species is Near Threatened (NT) at global level. The present work is an inventory of tree species of Yadahalli Chinkara Wildlife Sanctuary, Bagalkot, in view to create awareness among the local people and to support the conservation activities in the forest.
Horizon e-Publishing Group
2021-10-01 07:27:50
Peer-reviewed Article
application/pdf
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/1278
Plant Science Today; Vol. 8 No. 4 (2021)
eng
Copyright (c) 2021 Maheshwari Koti, K Kotresha
oai:ojs.horizonepublishing.com:article/1294
2021-12-04T12:28:03Z
PST:RCOM
driver
nmb a2200000Iu 4500
"220205 2022 eng "
2348-1900
dc
Influence of thermal treatment on Anthocyanin, total phenolic content and antioxidant capacity of Pigmented Maize (Zea mays L.)
Minh, Nguyen Phuoc
Institute of Applied Technology, Thu Dau Mot University, Binh Duong Province, Vietnam https://orcid.org/0000-0001-5425-5277
Pigmented maize (Zea mays L.) is a healthy crop due to its perfect proximates and phytochemicals. Thermal treatment was widely used to enhance phytochemical constituents in different kinds of crops. This research evaluated the impact of temperature (100, 115, 130 °C) and duration (10, 15, 20 min) in roasting to anthocyanin, total phenolic content and antioxidant capacity of pigmented maize. Results showed that thermal treatment at 115 °C in 10 min significantly improved anthocyanin in pigmented maize; however, this content would be lower at higher temperatures or prolonged exposing time. Meanwhile, total phenolic content and antioxidant capacity in the pigmented maize were recorded at the highest level when being roasted at 100 oC for 10 min. This research proved that phytochemical constituents and antioxidant capacity inside the pigmented maize would be seriously damaged at high temperatures and extended duration in roasting. By this, producers should pay more attention to thermal conditions in roasting.
Horizon e-Publishing Group
2021-10-01 07:27:50
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/1294
Plant Science Today; Vol. 8 No. 4 (2021)
eng
Copyright (c) 2021 Nguyen Phuoc Minh
oai:ojs.horizonepublishing.com:article/1343
2021-12-04T12:28:03Z
PST:RCOM
driver
nmb a2200000Iu 4500
"211004 2021 eng "
2348-1900
dc
Rediscovery, resurrection and lectotypification of endemic Isoetes sampathkumarnii L. N. Rao from India
Patil, Sachin
Department of Botany, Faculty of Science, The Maharaja Sayajirao University of Baroda, Vadodara 390 002, India https://orcid.org/0000-0001-6408-1901
Patil, Satish
Department of Botany, Doodhsakhar Mahavidyalaya, Bidri 416 208, India
Patel, Suresh
Department of Botany, Gujarat Arts and Science College, Ellis Bridge, Ahmedabad 380 006, India https://orcid.org/0000-0001-6590-8528
Rajput, Kishore
Department of Botany, Faculty of Science, The Maharaja Sayajirao University of Baroda, Vadodara 390 002, India https://orcid.org/0000-0003-2058-0412
An interesting species of Isoetes was collected from Jambughoda, Wildlife Sanctuary, Gujarat. After a review of literature and comparison of the morphological characters with type specimens, it was identified as I. sampathkumarnii L. N. Rao. It is endemic species of south India and rediscovered after a lapse of 63 years. The species shows several features that make it unique in the genus. Earlier, I. sampathkumarnii was also treated as synonym of I. coromandelina L.f. and I. sahyadrii Mahabala. However, it has an idiosyncratic velum character and spore ornamentation that makes it different from other species. Hence, the authors resurrected it as a distinct species. The original material is ambiguous hence, a lectotype of I. sampathkumarnii has been designated here.
Horizon e-Publishing Group
2021-10-01 07:27:50
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/1343
Plant Science Today; Vol. 8 No. 4 (2021)
eng
Copyright (c) 2021 Sachin Patil, Satish Patil, Suresh Patel, Kishore Rajput
oai:ojs.horizonepublishing.com:article/1382
2022-08-31T16:38:13Z
PST:RCOM
driver
nmb a2200000Iu 4500
"220710 2022 eng "
2348-1900
dc
Molecular identification of three Habenaria species from Binh Chau-Phuoc Buu Nature Reserve, Vietnam
Van, Hong Thien
Institute of Biotechnology and Food Technology, Industrial University of Ho Chi Minh City
Nguyen, Thi Thao Quyen
Institute of Biotechnology and Food Technology, Industrial University of Ho Chi Minh City, No. 12 Nguyen Van Bao Street, Ward 4, Go Vap District, Ho Chi Minh City, Vietnam https://orcid.org/0000-0001-6106-3492
Nguyen, Thanh Dat
Institute of Biotechnology and Food Technology, Industrial University of Ho Chi Minh City, No. 12 Nguyen Van Bao Street, Ward 4, Go Vap District, Ho Chi Minh City, Vietnam https://orcid.org/0000-0002-8923-4262
Tram, Ngoc To
Institute of Biotechnology and Food Technology, Industrial University of Ho Chi Minh City, No. 12 Nguyen Van Bao Street, Ward 4, Go Vap District, Ho Chi Minh City, Vietnam https://orcid.org/0000-0003-3196-8404
Le, Hong Thia
Institute of Environmental Science, Engineering and Management, Industrial University of Ho Chi Minh City, No. 12 Nguyen Van Bao Street, Go Vap District, Ho Chi Minh City, Vietnam. https://orcid.org/0000-0003-3568-6084
Trinh, Ngoc Nam
Office of Science Management and International Affairs, Industrial University of Ho Chi Minh City, No. 12 Nguyen Van Bao Street, Go Vap District, Ho Chi Minh City, Vietnam. https://orcid.org/0000-0002-7983-7270
Le, Van Son
Binh Chau-Phuoc Buu Nature Reserve, Bung Rieng Ward, Xuyen Moc District, Ba Ria-Vung Tau Province, Vietnam https://orcid.org/0000-0003-0151-0646
The present provides molecular data for species of Habenaria diphylla (Nimmo) Dalzell, H. khasiana Hook.f. and H. rostellifera Rchb.f. collected from Binh Chau-Phuoc Buu Nature Reserve, Vietnam for the first time. Along with other DNA sequences from GenBank database, the phylogenetic trees for Habenaria species from Vietnam have been established.
Horizon e-Publishing Group
2022-07-01 02:55:57
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/1382
Plant Science Today; Vol. 9 No. 3 (2022)
eng
Copyright (c) 2022 Hong Thien Van, Thi Thao Quyen Nguyen, Thanh Dat Nguyen, Ngoc To Tram, Hong Thia Le, Ngoc Nam Trinh, Van Son Le
oai:ojs.horizonepublishing.com:article/1387
2022-05-09T12:28:32Z
PST:RCOM
driver
nmb a2200000Iu 4500
"220401 2022 eng "
2348-1900
dc
Anti-bacterial, Anti-oxidant and other Phytochemical Properties of Datura innoxia leaves
George, Ruby
Amity Institute of Biotechnology, Amity University, Uttar Pradesh, Lucknow, India – 226 028 https://orcid.org/0000-0002-1059-3124
Mathur, Priti
Amity Institute of Biotechnology, Amity University, Uttar Pradesh, Lucknow, India – 226 028 https://orcid.org/0000-0001-8081-5901
To investigate the phytochemicals present in the leaves of Datura innoxia and to assess its antioxidant and antibacterial properties in different organic solvents, leaf extracts were exposed to different standardized techniques. Folin–Ciocalteu method and Aluminium chloride method proved that the ethanolic extract has maximum phenolic content (72.35± 0.52 mg GAE/g) and flavonoid content (29.21± 1.25 mg EQ/g) respectively. The highest DPPH radical scavenging activity with IC50 value 91.398 µg/ml also was in the ethanolic extract as compared to methanol, hexane and chloroform extracts. Free radical scavenging and antioxidant property of extracts were observed in the sequence of ethanol>methanol>hexane>chloroform. There was a strong correlation between antioxidant activity with total phenolic (DPPH, R2 = 0.41; PPM, R2 = 0.25) and total flavonoid contents (DPPH, R2 = 0.39; PPM, R2=0.23). Ethanolic and methanolic extracts showed antibacterial potential against the tested pathogenic strains; Staphylococcus aureus and Escherichia coli with a zone of inhibition ranging between 16± 0.9 to 27.5±0.8 mm. This study has proved that ethanolic leaf extract of D. innoxia showed bacterial inhibition and antioxidant activities and this herb can be assessed as a potential therapeutic species.
Horizon e-Publishing Group
2022-04-01 09:04:32
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/1387
Plant Science Today; Vol. 9 No. 2 (2022)
eng
Copyright (c) 2021 Ruby George, Priti Mathur
oai:ojs.horizonepublishing.com:article/1433
2022-02-16T01:01:24Z
PST:RCOM
driver
nmb a2200000Iu 4500
"220101 2022 eng "
2348-1900
dc
Aposporic development of gametophyte in Sematophyllum subpinnatum (Brid.) E. Britton (Sematophyllaceae) from capsule wall
Mathew, Meenu
P.G. and Research Department of Botany, St. Peter’s College, Kolenchery, 682 311, Kerala, India https://orcid.org/0000-0002-3484-8515
Mathew, Abraham
P.G. and Research Department of Botany, St. Peter’s College, Kolenchery, 682 311, Kerala, India https://orcid.org/0000-0002-6422-2732
Sindu, N
P.G. and Research Department of Botany, St. Peter’s College, Kolenchery, 682 311, Kerala, India https://orcid.org/0000-0002-0531-0409
In the present study, an axenic culture of Sematophyllum subpinnatum (Brid.) E. Britton was attempted from spores. However, spores failed to germinate, but protonemata were seen arising from the diploid capsule wall cells by apospory. Few cells of the capsule wall turned green, and the protoplast divided, resulting in the extension of the protoplast as a germ tube, which developed into protonemata. Protonemata were less spreading, and adult gametophytes developed from these protonemata. The aposporic plants so developed were transferred to soil, and they showed normal growth but with decreased branching. No sex organs and sporophytes were seen. This is the first report of aposporic development of S. subpinnatum from the capsule wall.
Horizon e-Publishing Group
2022-01-01 00:00:00
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/1433
Plant Science Today; Vol. 9 No. 1 (2022)
eng
Copyright (c) 2021 Meenu Mathew, Abraham Mathew, N Sindu
oai:ojs.horizonepublishing.com:article/1469
2022-05-09T12:28:32Z
PST:RCOM
driver
nmb a2200000Iu 4500
"220401 2022 eng "
2348-1900
dc
Effect of Flame Treatment and Radiofrequency Electromagnetic Radiations on phenolic content in in vitro cultures of Ipomoea batatas
Bag, Urja
Department of Biotechnology, Manipal Institute of Technology, Manipal Academy of Higher Education, Manipal, Karnataka 576104 https://orcid.org/0000-0003-1371-1322
Narasimhan, S
Department of Biotechnology, Manipal Institute of Technology, Manipal Academy of Higher Education, Manipal, Karnataka 576104 https://orcid.org/0000-0002-7942-9832
Bindu, S
Department of Electrical and Electronics Engineering, Manipal Institute of Technology, Manipal Academy of Higher Education, Manipal, Karnataka 576104 https://orcid.org/0000-0001-5818-5050
In vitro grown callus cultures of Ipomoea batatas were exposed to flame treatment and electromagnetic radiations generated by mobile phone. The cultured tissues responded to the treatments as evidenced by the significant reduction of phenolic contents compared to controls. Even though the growth of the tissues was normal, there was a change in the phenolic content of the tissues. There exhibited not much significant variation among the treatments regarding the growth rate. The morphology and texture of the callus also remained the same. It has been concluded that like animal cells, plant cells also respond to non-ionizing radiations like electromagnetic radiation emitted by mobile phones.
Horizon e-Publishing Group
2022-04-01 09:04:32
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/1469
Plant Science Today; Vol. 9 No. 2 (2022)
eng
Copyright (c) 2021 Urja Bag, S Narasimhan, S Bindu
oai:ojs.horizonepublishing.com:article/1472
2023-01-01T09:07:33Z
PST:RCOM
driver
nmb a2200000Iu 4500
"230101 2023 eng "
2348-1900
dc
Solmsiella biseriata (Austin) Steere (Bryophyta: Erpodiaceae) – an addition to Bryoflora of Central India
Singh, Devendra
Botanical Survey of India, Kolkata, AJCB Indian Botanic Garden, Howrah – 711 103, West Bengal, India https://orcid.org/0000-0001-5780-5617
Barman , R. D
Botanical Survey of India, Kolkata, AJCB Indian Botanic Garden, Howrah – 711 103, West Bengal, India https://orcid.org/0000-0002-1061-3922
Saha, Titir
Botanical Survey of India, Kolkata, AJCB Indian Botanic Garden, Howrah – 711 103, West Bengal, India https://orcid.org/0000-0002-9214-3775
Solmsiella biseriata (Austin) Steere is recorded for the first time in Central India earlier known from Eastern and Western Ghats of India.
Horizon e-Publishing Group
2023-01-01 02:07:32
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/1472
Plant Science Today; Vol. 10 No. 1 (2023)
eng
Copyright (c) 2022 Devendra Singh, R. D Barman , Titir Saha
oai:ojs.horizonepublishing.com:article/1517
2022-08-31T16:38:13Z
PST:RCOM
driver
nmb a2200000Iu 4500
"220701 2022 eng "
2348-1900
dc
Extended distribution and assessment of conservation status of Impatiens exilis Hook. f. (Balsaminaceae) an endemic species of Eastern Himalaya
Baro, Daimalu
Department of Botany, Tinsukia College, Tinsukia-786 125, Assam, India https://orcid.org/0000-0001-6937-8990
Bawri, Amal
North Eastern Institute of Ayurveda & Folk Medicine Research (An Autonomous Institute under Ministry of Ayush, Govt. of India), Pasighat–791 102, Arunachal Pradesh, India https://orcid.org/0000-0003-1120-1994
Deka, Jyotishman
Department of Botany, Assam Don Bosco University, Guwahati-782 402, India https://orcid.org/0000-0003-2682-0659
Borthakur , Sachindra Kumar
Department of Botany, Gauhati University, Guwahati-781014, Assam, India https://orcid.org/0000-0002-5776-3792
The present communication reports an extended distribution of Impatiens exilis Hook. f., in North Eastern part of India. The species is so far reported from Sikkim only in India and endemic to eastern Himalaya. Present collection of Impatiens exilis Hook. f., from Panbari Range, Manas National Park, Assam extends its distribution territory to Assam in the North-Eastern Part of India. The analysis of its threat status suggests that the species is an endangered (EN) one. A detailed description with phenology and photographs has been provided for easy identification of the species.
Horizon e-Publishing Group
2022-07-01 02:55:57
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/1517
Plant Science Today; Vol. 9 No. 3 (2022)
eng
Copyright (c) 2022 Daimalu Baro, Amal Bawri, Jyotishman Deka, Sachindra Kumar Borthakur
oai:ojs.horizonepublishing.com:article/1710
2022-05-09T12:28:16Z
PST:RCOM
driver
nmb a2200000Iu 4500
"230130 2023 eng "
2348-1900
dc
An account on promising alternative system of medicine to boost immunity
Sasikala, K
PG Dept. of Botany, Mahatma Gandhi Govt. Arts College, Mahe - 673 311, U.T. of Puducherry, India https://orcid.org/0000-0001-7994-719X
Reema Kumari , M
P.G. Dept. of Botany, Maharani Lakshmi Ammanni College for Women (Autonomous), Bengaluru - 560 012, India. https://orcid.org/0000-0001-6531-5650
One has to build up the immune system in order to fight against the pathogens. Nowadays, due to the sedentary life style and stressful life severe health issues occur. By increasing the number of physical activities one can reduce the effect of it. The present study outlines how to improve the immune system by Alternate Traditional System of Medicine. Details on some of the plant-based immunity boosters are provided here to help prevent and fight against infection. The methods adopted to administrate the medicines are in the form of decoction, concoction or extraction. For a healthy immune system, a plant product or a combination of products such as spices, fruits, vegetables are used. A healthy life style along with a balanced diet could support and boost one’s immune system.
Horizon e-Publishing Group
2022-05-09 06:28:16
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/1710
Plant Science Today; Vol. 9 No. sp2 (2022)
eng
Copyright (c) 2022 K Sasikala, M Reema Kumari
oai:ojs.horizonepublishing.com:article/1747
2023-01-01T09:07:33Z
PST:RCOM
driver
nmb a2200000Iu 4500
"230101 2023 eng "
2348-1900
dc
Tectaria polymorpha (Wall. ex Hook.) Copel. (Tectariaceae), a new distributional record for Kerala
Raju, Reshma
Department of Botany, University of Kerala, Kariavattom, Thiruvananthapuram, Kerala 695 581, India https://orcid.org/0000-0003-1319-808X
Raj , Jithin
Jawaharlal Nehru Tropical Botanic Garden and Research Institute, Palode, Thiruvananthapuram, Kerala 695 562, India https://orcid.org/0000-0002-3924-3558
A , Gangaprasad
Centre for Biodiversity, University of Kerala, Kariavattom, Thiruvananthapuram, Kerala 695 581, India
Tectaria polymorpha (Wall. ex Hook.) Copel., is a rare species belongs to the family Tectariaceae. In southern India, so far it has been reported from Karnataka and Tamil Nadu States only. We report the occurrence of this species in Kerala State from Shendurney Wildlife Sanctuary, a part of Agasthyamala Biosphere Reserve. Taxonomic treatment with detailed description, specimens examined, ecology, distribution, note, key to the species of Kerala and photographs are provided here for its easy identification.
Horizon e-Publishing Group
2023-01-01 02:07:32
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/1747
Plant Science Today; Vol. 10 No. 1 (2023)
eng
Copyright (c) 2022 Reshma Raju, Jithin Raj , Gangaprasad A
oai:ojs.horizonepublishing.com:article/1766
2022-10-01T11:08:45Z
PST:RCOM
driver
nmb a2200000Iu 4500
"221001 2022 eng "
2348-1900
dc
Rehydration kinetics of thin layer-dried red Amaranth (Amaranthus tricolor L.) leaves
Sultana, Arjuma
Department of Food Technology and Biochemical Engineering, Jadavpur University, Kolkata-700 032, India https://orcid.org/0000-0003-1702-4511
Ghosh, Uma
Department of Food Technology and Biochemical Engineering, Jadavpur University, Kolkata-700 032, India
The rehydration behaviour of a thin layer dried red Amaranth leaves were studied at various temperatures 38°C, 50°C, 60°C and 80°C. Three types of pretreated samples were used for this rehydration process: normal, chlorinated and processed. Pretreated samples were dried at 50°C, 60°C and 80°C temperature. The rehydration process of the dried red amaranth leaves were satisfactorily described by the Peleg’s equation. According to the Peleg’s equation rehydration temperature increases from 38°C to 80°C, then the rate of rehydration constant K1 significantly decreases and the capacity constant K2 varies with different temperatures of rehydration. The increase in rehydration ratio was significant only as temperature increased from 38°C to 80°C.
Horizon e-Publishing Group
2022-10-01 05:08:45
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/1766
Plant Science Today; Vol. 9 No. 4 (2022)
eng
Copyright (c) 2022 Arjuma Sultana, Uma Ghosh
oai:ojs.horizonepublishing.com:article/1798
2022-10-01T11:08:45Z
PST:RCOM
driver
nmb a2200000Iu 4500
"221001 2022 eng "
2348-1900
dc
First record of the occurrence of Pleurotus species on new hosts in Bengaluru, Karnataka, India
Nagadesi, Praveen Kumar
Department of Botany, School of Life Science, St. Joseph’s University, Lalbagh Road, Bengaluru – 560 027, Karnataka, India https://orcid.org/0000-0002-9474-0565
Stephen , A
Department of Botany, School of Life Science, St. Joseph’s University, Lalbagh Road, Bengaluru – 560 027, Karnataka, India https://orcid.org/0000-0002-3991-7380
Mushrooms have wide geographical distribution, with greatest commercial importance, both in temperate areas and tropical regions of the world. The agarics mycota of tropical eco-regions of Bengaluru, Karnataka was surveyed in different seasons from 2019 to 2020 for collection and identification of fungal samples. Detailed macroscopic and microscopic study of fungal samples was identified as Pleurotus pulmonarius (Fr.) Quél. P. ostreatus (Jack.) P. Kumm. P. populinus O. Hilber & O. K. Mill. For the first time, P. pulmonarius (Fr.) Quél was causing stem decay in Mangifera indica L. was reported from India. New host record of P. populinus O. Hilber & O. K. Mill on Spathodea campanulata was reported from India. Three species of Pleurotus was reported for the first time from the study area of Bengaluru, Karnataka, India.
Horizon e-Publishing Group
2022-10-01 05:08:45
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/1798
Plant Science Today; Vol. 9 No. 4 (2022)
eng
Copyright (c) 2022 Praveen Kumar Nagadesi, A Stephen
oai:ojs.horizonepublishing.com:article/1804
2022-08-31T16:05:38Z
PST:RCOM
driver
nmb a2200000Iu 4500
"221002 2022 eng "
2348-1900
dc
Current state of Anabasis salsa pasture varieties in Karakalpak Ustyurt (Uzbekistan) due to Aral Sea drying
Rakhimova, Nodira
Laboratory of Geobotany, Institute of Botany, Academy of Sciences, Republic of Uzbekistan, 100125 Tashkent, Uzbekistan
Rakhimova , Tashkhanim
Laboratory of Geobotany, Institute of Botany, Academy of Sciences, Republic of Uzbekistan, 100125 Tashkent, Uzbekistan
Sadinov, Jasur S
Laboratory of Geobotany, Institute of Botany, Academy of Sciences, Republic of Uzbekistan, 100125 Tashkent, Uzbekistan
This article is devoted to the study of the current state of 2 pasture varieties of the biyurgun type: Anabasis salsa with the participation of Caroxylon orientale, Artemisia terrae-albae and A. kemrudica; Anabasis salsa with Caroxylon orientale and Artemisia terra-albae and Convolvulus fruticosus, Lycium ruthenicum, Anabasis brachiata, Nanophyton erinaceum, Nitraria schoberi, Malacocarpus crithmifolius and Xylosalsola chiwensis, with single Crambe edentula specimens distributed across the territory of Karakalpak Ustyurt (Uzbekistan) under the influence of Aral Sea drying. The Anabasis salsa pasture type occupies a larger area than that occupied by the other pasture types in Karakalpak Ustyurt (2 664 774 ha) and accounts for 36.4% of the total territory, which includes 9 pasture varieties. This type is common on takyr, loamy saline soils and, high-gypsum soils. The area of the studied pasture varieties, soil cover nature, projective cover percentage, landscape plant species, species placement, forage yield and recommended seasonality of use were determined. According to our observations the investigated pasture varieties are recommended for use as autumn-winter pastures.
Horizon e-Publishing Group
2022-08-31 10:05:38
Peer-reviewed Article
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/1804
Plant Science Today; Vol. 9 No. sp3 (2022)
eng
Copyright (c) 2022 Nodira Rakhimova, Tashkhanim Rakhimova , Jasur S Sadinov
oai:ojs.horizonepublishing.com:article/1815
2022-10-01T11:08:45Z
PST:RCOM
driver
nmb a2200000Iu 4500
"221001 2022 eng "
2348-1900
dc
Diversity of medicinally important leafy vegetables used by the tribes in Balasore district of Odisha, India
Noor, Niquehat
School of Applied Sciences, Centurion University of Technology and Management, Bhubaneswar-752 050, India https://orcid.org/0000-0001-7357-6498
Satapathy, Kunja Bihari
School of Applied Sciences, Centurion University of Technology and Management, Bhubaneswar-752 050, India https://orcid.org/0000-0003-0824-3667
With an increase in the incidence and outbreak of several new diseases, plant-based medications are becoming increasingly popular owing to their low cost and fewer adverse effects. In this context, the leafy vegetables being enriched in nutritional and therapeutic value are in focus in order to uncover their hidden potential for human welfare. In this backdrop, the present study was undertaken in the Balasore district of Odisha, India to document the ethnomedicinally significant leafy vegetables consumed by the local tribes of the region. A total of 72 leafy vegetables belonging to 35 families under 69 genera were reported with ethnomedicinal uses. The data on information related to their uses was collected through scientifically structured questionnaires, interviews and close interactions with 192 informants. The results also included the determination of fidelity level (FL) along with factor informant consensus value (Fic). Nyctanthes arbor-tristis L., with a fidelity level of 98.77%, is the most commonly used medicinally potent leafy vegetable. Diabetes had a higher Factor Informant Consensus value (Fic) of 0.994, similar to the common cold and cough disease. The findings of the present study suggested that most of the underutilised leafy vegetables under study possessed curative values and needed further investigation to prove their efficacy against specific diseases reported. Furthermore, these leafy vegetables need immediate attention for their conservation and sustainable utilization and efforts should be made to safeguard the traditional knowledge of tribal communities, which is under threat of extinction.
Horizon e-Publishing Group
2022-10-01 05:08:45
Peer-reviewed Article
application/pdf
application/pdf
http://horizonepublishing.com/journals/index.php/PST/article/view/1815
Plant Science Today; Vol. 9 No. 4 (2022)
eng
Copyright (c) 2022 Niquehat Noor, Kunja Bihari Satapathy
fb4d3006c04a4ffaf06d03183fc2dc4d