Phylogenetic study of mangrove associate grass Myriostachya wightiana (Nees ex Steud.) Hook. f. using rbcL gene sequence

K M Kiran; B V Sandeep

doi:10.14719/pst.2021.8.3.1133

Authors

K M Kiran Department of Biotechnology, College of Science and Technology, Andhra University, Visakhapatnam, Andhra Pradesh, India https://orcid.org/0000-0002-5168-1876
B V Sandeep Department of Biotechnology, College of Science and Technology, Andhra University, Visakhapatnam, Andhra Pradesh, India https://orcid.org/0000-0003-3409-4802

DOI:

https://doi.org/10.14719/pst.2021.8.3.1133

Keywords:

PCR amplification, BLASTn, MEGAX, Multiple sequence alignment, Poaceae

Abstract

Myriostachya is a monotypic genus in the family Poaceae, with the only known species Myriostachya wightiana (Nees ex Steud.) Hook.f. It is a mangrove associate grass primarily distributed along the muddy streams and channels in intertidal mangrove swamps of India, Bangladesh, Sri Lanka, Myanmar, Thailand and Sumatra. Molecular identification and evolutionary studies of M. wightiana is unreported till now. Therefore, in this study, the phylogenetic analysis of M. wightiana was established with related family members by using chloroplast rbcL gene-based systematics. The molecular phylogeny was accomplished by DNA extraction, PCR amplification and sequencing of the rbcL gene and phylogenetic analysis. The genomic DNA was extract using the CTAB method and the rbcL gene amplification is by using the F-5IATGTCACCACAAACAGAAACTAAAGC3I and R-5ICTTCGGCACAAAATAAGAAACGATCTC3I primers. Phylogenetic analysis of M. wightiana was performed by multiple sequence alignment with UPGMA, and the Maximum-parsimony phylogenetic tree was constructed using MEGAX. Myriostachya wightiana rbcL gene sequence shows the highest similarity to Paspalum species, and in the phylogenetic tree M. wightiana has a close branch with Paspalum vaginatum. The evolutionary divergence from M. wightiana is maximum (0.49) to Sorghum propinquum and minimum (0.01) to Oryza officinalis and Oryza punctata. This study concluded that M. wightiana has a strong morphological and phylogenetic relationship with salt-tolerant Paspalum sp.

Downloads

Download data is not yet available.

Author Biographies

K M Kiran, Department of Biotechnology, College of Science and Technology, Andhra University, Visakhapatnam, Andhra Pradesh, India

Dr. M. Kiran Kumar is working as guest faculty in the Department of Biotechnology, Andhra University, Visakhapatnam, Andhra Pradesh, India. He obtained his M.Sc. degree in Biotechnology from Andhra University and qualified CSIR-JRF, ICAR, GATE and APSET. He joined for his PhD research in Andhra University. He has published several scientific articles in various national and international journals. His research interest is Plant Biotechnology and Molecular Biology.

B V Sandeep, Department of Biotechnology, College of Science and Technology, Andhra University, Visakhapatnam, Andhra Pradesh, India

Prof. B.V. Sandeep obtained his MSc from Andhra University, India in 1978 and he later pursued Ph.D. from the Andhra University. Now he works as Professor in Dept. of Zoology and Dept. of Biotechnology. He has published 53 scientific research articles in professional journals and his research interest in Parasitology, Toxicology, Protistology and Molecular Biology. Member SEAC, nominated by MoEF & CC.

References

Hooker JD,. The Flora of British India. 1897;7:327-28.

Gilliland HB. A revised flora of Malaya, The Royal Botanic Gardens, Singapore. 1971;3:1-319.

Rashid P, Ahmed A. Anatomical adaptation of Myriostachya wightiana Hook. f. to salt stress. Dhaka Univ. J Biol Sci. 2011; 20(2):205?08. http://doi.org/10.3329/dujbs.v20i2.8982

Stebbins GL. Grass systematics and evolution: past, present and future. In: Soderstrom TR, Hilu KW, Campbell CS, Barkworth ME (editors.). Grass Systematics and Evolution. Washington D.C: Smithsonian Institute; 1987. P. 359-67.

Walker JM. Methods in Molecular Biology. TM Series editor. Life Sciences. UK: University of Hertfordshire; 2009. Vol. 531.

Prendini L. Scorpion diversity and distribution in southern Africa: pattern and process. In: Huber BA, Sinclair BJ, Lampe KH (editors.). In: African Biodiversity: Molecules, Organisms, Ecosystems, Proceedings of the 5th International Symposium on Tropical Biology. Bonn, Germany. New York; 2005. p. 25-68.

Dharmayanti NLPI. Filogenetika molekuler: metode taksonomi organisme berdasarkan sejarah evolusi. Wartazoa. 2011;21:1-10.

Donoghue MJ, Olmstead RG, Smith JF, Palmer JD. Phylogenetic relationships of Dipsacales based on rbcL sequences. Annals of the Missouri Botanic Garden. 1993;79:333-45. http://doi.org/10.2307/2399772

Doebley J, Durbin M, Golenberg EM, Clegg MT, Ma DP. Evolutionary analysis of the large subunit of carboxylase (rbcL) nucleotide sequence among the grasses (Gramineae). Evolution 1990;44:1097-08. http://doi.org/10.1111/j.1558-5646.1990.tb03828.x

Lin MT, Occhialini A, Andralojc PJ, Parry MAJ, Hanson MR. A faster Rubisco with potential to increase photosynthesis in crops. Nature. 2014; 513: 547-50. http://doi.org/10.1038/nature13776

Yoon CS, Glawe DA, Shaw PD. A method for rapid small-scale preparation of fungal DNA. Mycologia. 1991;83:835-38.

Gendimenico GJ, Bouquin PL, Tramposch KM. Diphenylamine-colorimetric method for DNA assay: a shortened procedure by incubating samples at 50 °C. Anal Biochem. 1988; 173:45-48. http://doi.org/10.1016/0003-2697(88)90156-x

Levin RA, Wagner WL, Hoch PC, Nepokroeff M, Pires JC, Zimmer EA, Sytsma KJ. Family-level relationships of Onagraceae based on chloroplast rbcL and ndhF data. American Journal of Botany. 2003;90:107-15. http://doi.org/10.3732/ajb.90.1.107

Kress WJ, Erickson DL. A two-locus global DNA barcode for land plants: The coding rbcL gene complements the noncoding trnH-psbA spacer region. PLoS ONE 2. 2007; e508. http://doi.org/10.1371/journal.pone.0000508

Felsenstein J. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 1985b;39:783-91. http://doi.org/10.1111/j-1558-5646.1985.tb00420.x

Gutteridge A, Burns M. The Application of DNA Molecular Approaches for the Identification of Herbal Medicinal Products. Journal of the Association of Public Analysts. 2013;41:53-66.

Clegg MT, Zurawski G. Chloroplast DNA and the study of plant phylogeny. In: Soltis PS, Soltis DE, Doyle JJ, editors. Molecular systematics of plants. Chapman and Hall: New York; 1991. p.1-13.

Raven JA, Allen JF. Genomics and chloroplast evolution: what did cyanobacteria do for plants?. Genome Biol. 2003;4(3):209.1-5. http://doi.org/10.1186/gb-2003-4-3-209

Muller K. SeqState: primer design and sequence statistics for phylogenetic DNA datasets. Appl Bioinforma. 2005;4:65-69. http://doi.org/10.2165/00822942-200504010-00008

Kusumi J, Tachida H. Compositional properties of green plant plastid genomes. J Mol Evol. 2005;60:417-25. http://doi.org/10.1007/s00239-004-0086-8

Rahman IA. Biochemical, molecular and phylogenetic studies of selected wild Solanum sp. of Meghalaya. PhD thesis. Dept. of Botany, North-Eastern Hill University, Shillong; India. 2014. http://hdl.handle.net/10603/68010